RchiOBHm_Chr1g0359651

Phosducin-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
51540551 .. 51540864
314 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGGGGGACTATCACTATATCTACAAGGATTTGGACGGAGCCTCCACGCAGTGGGACTATATTCAGGCAAAGCTCGGCAATCTTCCGCCTAAGAAACCGGCGTTTAAGCCTCCTCCCTTCTCTCCGGCAGAGGACGAAGCCTCTCTTCCTAAAGACAAGTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.07

Weight (kDa)

5.58

Isoelectric Point (pI)

47.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 51
AciI CCGC 1 cut(s) 86
AdeI CACNNNGTG 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 51
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
BmiI GGNNCC 1 cut(s) 40
BsaXI ACNNNNNCTCC 2 cut(s) 26, 56
Bsc4I CCNNNNNNNGG 1 cut(s) 51
Bse118I RCCGGY 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 51
BseRI GAGGAG 1 cut(s) 102
BsiSI CCGG 2 cut(s) 98, 125
BslFI GGGAC 2 cut(s) 20, 68
BslI CCNNNNNNNGG 1 cut(s) 51
BsmFI GGGAC 2 cut(s) 20, 68
BspACI CCGC 1 cut(s) 86
BspLI GGNNCC 1 cut(s) 40
BsrFI RCCGGY 1 cut(s) 97
BssAI RCCGGY 1 cut(s) 97
Bst6I CTCTTC 1 cut(s) 150
BstDEI CTNAG 2 cut(s) 90, 162
BtsI GCAGTG 1 cut(s) 56
BtsIMutI CAGTG 1 cut(s) 56
Cfr10I RCCGGY 1 cut(s) 97
CviJI RGCY 4 cut(s) 41, 73, 109, 140
CviKI_1 RGCY 4 cut(s) 41, 73, 109, 140
DdeI CTNAG 2 cut(s) 90, 162
DraIII CACNNNGTG 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
EciI GGCGGA 1 cut(s) 75
FaiI YATR 2 cut(s) 18, 60
FalI AAGNNNNNCTT 2 cut(s) 129, 161
FaqI GGGAC 2 cut(s) 20, 68
HapII CCGG 2 cut(s) 98, 125
HpaII CCGG 2 cut(s) 98, 125
HpyAV CCTTC 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 90, 162
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 3 cut(s) 50, 111, 138
MboII GAAGA 2 cut(s) 74, 137
MnlI CCTC 5 cut(s) 52, 120, 123, 124, 151
MseI TTAA 1 cut(s) 105
MspI CCGG 2 cut(s) 98, 125
NlaIV GGNNCC 1 cut(s) 40
NmeAIII GCCGAG 1 cut(s) 54
PflMI CCANNNNNTGG 1 cut(s) 51
PspN4I GGNNCC 1 cut(s) 40
SaqAI TTAA 1 cut(s) 105
SetI ASST 1 cut(s) 75
SgeI CNNG 6 cut(s) 37, 58, 77, 86, 110, 137
SsiI CCGC 1 cut(s) 86
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 56
TspGWI ACGGA 1 cut(s) 51
TspRI CASTG 1 cut(s) 56
Van91I CCANNNNNTGG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.