Rh1AG466100

Phosducin-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
68087934 .. 68088161
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG466100.1

Sequence Viewer

Length: 228 bp
ATGGACACAGACATCCTCGAATATCTTGTTGTATCTTCGAGGATGGGGGACTATCACTATATCTACAAGGACTTGGACGGAGCCTCCACCGAGTGGAACGATAATCAGGCTAAGCTTGGCAATCTTCCGCCCAAGAAACCAGCGTTTAAGCCTCCTCCCTTCACTCCGGCCGACGACGAAGCCTCTCTTCCTAAAGACAATTCTTGGACCGATGACAAGACCCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.5

Weight (kDa)

4.41

Isoelectric Point (pI)

32.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 93
AciI CCGC 1 cut(s) 128
AcoI YGGCCR 1 cut(s) 168
AdeI CACNNNGTG 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 93
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
AoxI GGCC 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 207
AvaII GGWCC 1 cut(s) 207
BccI CCATC 1 cut(s) 37
BlpI GCTNAGC 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 82
Bpu1102I GCTNAGC 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
Bsc4I CCNNNNNNNGG 1 cut(s) 93
BseGI GGATG 2 cut(s) 12, 48
BseLI CCNNNNNNNGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 144
BseX3I CGGCCG 1 cut(s) 168
Bsh1285I CGRYCG 1 cut(s) 171
BshFI GGCC 1 cut(s) 170
BsiEI CGRYCG 1 cut(s) 171
BsiSI CCGG 1 cut(s) 167
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 170
Bsp1720I GCTNAGC 1 cut(s) 111
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 2 cut(s) 12, 48
BstMCI CGRYCG 1 cut(s) 171
BstZI CGGCCG 1 cut(s) 168
BsuRI GGCC 1 cut(s) 170
BtsCI GGATG 2 cut(s) 12, 48
Cfr13I GGNCC 1 cut(s) 207
CviJI RGCY 6 cut(s) 83, 110, 115, 151, 170, 182
CviKI_1 RGCY 6 cut(s) 83, 110, 115, 151, 170, 182
DdeI CTNAG 1 cut(s) 111
DraIII CACNNNGTG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 168
EagI CGGCCG 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
EciI GGCGGA 1 cut(s) 117
EclXI CGGCCG 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 207
Eco52I CGGCCG 1 cut(s) 168
FaiI YATR 1 cut(s) 60
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FaqI GGGAC 1 cut(s) 62
FokI GGATG 1 cut(s) 55
HaeIII GGCC 1 cut(s) 170
HapII CCGG 1 cut(s) 167
HindIII AAGCTT 1 cut(s) 113
HpaII CCGG 1 cut(s) 167
Hpy99I CGWCG 2 cut(s) 176, 179
HpyAV CCTTC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 111
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 3 cut(s) 92, 153, 180
MboII GAAGA 3 cut(s) 27, 116, 179
MluCI AATT 1 cut(s) 199
MnlI CCTC 6 cut(s) 26, 33, 94, 162, 165, 193
MseI TTAA 1 cut(s) 147
MspI CCGG 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 82
PflMI CCANNNNNTGG 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 207
SetI ASST 1 cut(s) 117
SinI GGWCC 1 cut(s) 207
Sse9I AATT 1 cut(s) 199
SsiI CCGC 1 cut(s) 128
TaqI TCGA 2 cut(s) 18, 38
TaqII GACCGA 1 cut(s) 224
TasI AATT 1 cut(s) 199
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 93
Van91I CCANNNNNTGG 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.