Rh4AG255500

Phosducin-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
57027741 .. 57027968
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG255500.1

Sequence Viewer

Length: 228 bp
ATGGACACAGACATCCTCGAATATCTTGTTGTATCTTCGAGGATGGGGGACTATCACTATATCTACAAGGACTTGGACGGAGCCTCCACCGAGTGGAACGATAATCAGGCTAAGCTTGGCAATCTTCCGCCTAAGAAACCAGTGTTTAAGCCTCTTCCCTTCACTCTGGCCGACGACGAAGCCACTCTTCCTAAAGACAATTCTTGGACCGATGACAAGACCCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.58

Weight (kDa)

4.41

Isoelectric Point (pI)

27.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 93
AciI CCGC 1 cut(s) 128
AcoI YGGCCR 1 cut(s) 168
AdeI CACNNNGTG 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 93
AluBI AGCT 1 cut(s) 115
AluI AGCT 1 cut(s) 115
AoxI GGCC 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 207
AvaII GGWCC 1 cut(s) 207
BccI CCATC 1 cut(s) 37
BlpI GCTNAGC 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 82
Bpu1102I GCTNAGC 1 cut(s) 111
BsaXI ACNNNNNCTCC 2 cut(s) 68, 98
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 140
BseGI GGATG 2 cut(s) 12, 48
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 140
BshFI GGCC 1 cut(s) 170
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 93
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 170
Bsp1720I GCTNAGC 1 cut(s) 111
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 170
BspLI GGNNCC 1 cut(s) 82
BsrI ACTGG 1 cut(s) 140
Bst6I CTCTTC 2 cut(s) 159, 192
BstDEI CTNAG 2 cut(s) 111, 132
BstF5I GGATG 2 cut(s) 12, 48
BsuRI GGCC 1 cut(s) 170
BtsCI GGATG 2 cut(s) 12, 48
BtsIMutI CAGTG 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 207
CviJI RGCY 6 cut(s) 83, 110, 115, 151, 170, 182
CviKI_1 RGCY 6 cut(s) 83, 110, 115, 151, 170, 182
DdeI CTNAG 2 cut(s) 111, 132
DraIII CACNNNGTG 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 168
Eam1104I CTCTTC 2 cut(s) 159, 192
EarI CTCTTC 2 cut(s) 159, 192
EciI GGCGGA 1 cut(s) 117
Eco47I GGWCC 1 cut(s) 207
FaiI YATR 1 cut(s) 60
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FaqI GGGAC 1 cut(s) 62
FokI GGATG 1 cut(s) 55
HaeIII GGCC 1 cut(s) 170
HindIII AAGCTT 1 cut(s) 113
Hpy99I CGWCG 2 cut(s) 176, 179
HpyAV CCTTC 1 cut(s) 169
HpyF3I CTNAG 2 cut(s) 111, 132
LmnI GCTCC 1 cut(s) 80
LpnPI CCDG 3 cut(s) 92, 152, 153
MboII GAAGA 4 cut(s) 27, 116, 146, 179
MluCI AATT 1 cut(s) 199
MnlI CCTC 4 cut(s) 26, 33, 94, 162
MseI TTAA 1 cut(s) 147
NlaIV GGNNCC 1 cut(s) 82
PflMI CCANNNNNTGG 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 147
Sau96I GGNCC 1 cut(s) 207
SetI ASST 1 cut(s) 117
SinI GGWCC 1 cut(s) 207
Sse9I AATT 1 cut(s) 199
SsiI CCGC 1 cut(s) 128
TaqI TCGA 2 cut(s) 18, 38
TaqII GACCGA 1 cut(s) 224
TasI AATT 1 cut(s) 199
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 93
TspRI CASTG 1 cut(s) 147
Van91I CCANNNNNTGG 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.