Rh2AG660500

CONTAINS InterPro DOMAIN s Thioredoxin fold (InterPro IPR012335), Phosducin (InterPro IPR001200), Thioredoxin-like fold (InterPro IPR012336)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
87619578 .. 87620477
900 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG660500.1

Sequence Viewer

Length: 267 bp
ATGGAACATCACTTTGTGTACAAAGACTTGGACGGAGCGTCGACGCAGTGGAACGATATACAGGCAAAGCTAGAGAATATTCGGAAGAAGCCACCGGCGTTCTATCCGCCAGCTTTCACTCCTTCGGAGGACGAAGCCTCTCTTCCTGAAGACAAGAAGTGGATCGAGCGAGCAGGACCTCGAAGATCTCAAAGACGATCCCGATCTCGACGACGACGATCGATTCCTCGAGGAATACAGGAGGAAGAGGCTAGCTCTCAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.36

Weight (kDa)

9.76

Isoelectric Point (pI)

109.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 228
AccI GTMKAC 1 cut(s) 41
AciI CCGC 1 cut(s) 107
AclWI GGATC 2 cut(s) 170, 192
AcuI CTGAAG 1 cut(s) 168
AdeI CACNNNGTG 1 cut(s) 16
AfaI GTAC 1 cut(s) 20
AhdI GACNNNNNGTC 1 cut(s) 37
AluBI AGCT 3 cut(s) 70, 113, 255
AluI AGCT 3 cut(s) 70, 113, 255
AlwI GGATC 2 cut(s) 170, 192
Ama87I CYCGRG 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 176
AsuNHI GCTAGC 1 cut(s) 251
AvaI CYCGRG 1 cut(s) 228
AvaII GGWCC 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 156
BfaI CTAG 2 cut(s) 71, 252
BglII AGATCT 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 176
BmeRI GACNNNNNGTC 1 cut(s) 37
BmeT110I CYCGRG 1 cut(s) 228
BmgT120I GGNCC 1 cut(s) 176
BmtI GCTAGC 1 cut(s) 255
BpiI GAAGAC 1 cut(s) 156
BplI GAGNNNNNCTC 1 cut(s) 239
Bsa29I ATCGAT 1 cut(s) 221
BsaBI GATNNNNATC 1 cut(s) 202
Bse118I RCCGGY 1 cut(s) 94
Bse8I GATNNNNATC 1 cut(s) 202
BseCI ATCGAT 1 cut(s) 221
BseJI GATNNNNATC 1 cut(s) 202
Bsh1285I CGRYCG 1 cut(s) 221
BshVI ATCGAT 1 cut(s) 221
BsiEI CGRYCG 1 cut(s) 221
BsiHKCI CYCGRG 1 cut(s) 228
BsiSI CCGG 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 228
Bsp1407I TGTACA 1 cut(s) 18
Bsp143I GATC 5 cut(s) 162, 185, 197, 203, 218
BspACI CCGC 1 cut(s) 107
BspDI ATCGAT 1 cut(s) 221
BspOI GCTAGC 1 cut(s) 255
BspPI GGATC 2 cut(s) 170, 192
BsrFI RCCGGY 1 cut(s) 94
BsrGI TGTACA 1 cut(s) 18
BssAI RCCGGY 1 cut(s) 94
BssMI GATC 5 cut(s) 162, 185, 197, 203, 218
Bst6I CTCTTC 2 cut(s) 147, 240
BstAUI TGTACA 1 cut(s) 18
BstC8I GCNNGC 3 cut(s) 111, 171, 253
BstDEI CTNAG 1 cut(s) 258
BstKTI GATC 5 cut(s) 165, 188, 200, 206, 221
BstMBI GATC 5 cut(s) 162, 185, 197, 203, 218
BstMCI CGRYCG 1 cut(s) 221
BstV2I GAAGAC 1 cut(s) 156
BstX2I RGATCY 1 cut(s) 185
BstYI RGATCY 1 cut(s) 185
Bsu15I ATCGAT 1 cut(s) 221
BsuTUI ATCGAT 1 cut(s) 221
BtsI GCAGTG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 53
Cac8I GCNNGC 3 cut(s) 111, 171, 253
Cfr10I RCCGGY 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 176
ClaI ATCGAT 1 cut(s) 221
CseI GACGC 2 cut(s) 27, 52
Csp6I GTAC 1 cut(s) 19
CviJI RGCY 6 cut(s) 70, 91, 113, 137, 251, 255
CviKI_1 RGCY 6 cut(s) 70, 91, 113, 137, 251, 255
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 1 cut(s) 258
DpnI GATC 5 cut(s) 164, 187, 199, 205, 220
DpnII GATC 5 cut(s) 162, 185, 197, 203, 218
DraIII CACNNNGTG 1 cut(s) 16
DriI GACNNNNNGTC 1 cut(s) 37
Eam1104I CTCTTC 2 cut(s) 147, 240
Eam1105I GACNNNNNGTC 1 cut(s) 37
EarI CTCTTC 2 cut(s) 147, 240
EciI GGCGGA 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 176
Eco57I CTGAAG 1 cut(s) 168
Eco88I CYCGRG 1 cut(s) 228
EcoO109I RGGNCCY 1 cut(s) 176
FaiI YATR 1 cut(s) 59
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FblI GTMKAC 1 cut(s) 41
FspBI CTAG 2 cut(s) 71, 252
HapII CCGG 1 cut(s) 95
HgaI GACGC 2 cut(s) 27, 52
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 1 cut(s) 223
HpaII CCGG 1 cut(s) 95
Hpy166II GTNNAC 2 cut(s) 19, 42
Hpy188I TCNGA 3 cut(s) 84, 127, 261
Hpy188III TCNNGA 3 cut(s) 146, 201, 207
Hpy8I GTNNAC 2 cut(s) 19, 42
Hpy99I CGWCG 5 cut(s) 43, 46, 213, 216, 219
HpyAV CCTTC 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 258
Kzo9I GATC 5 cut(s) 162, 185, 197, 203, 218
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 6 cut(s) 47, 108, 123, 159, 159, 224
MaeI CTAG 2 cut(s) 71, 252
MalI GATC 5 cut(s) 164, 187, 199, 205, 220
MboI GATC 5 cut(s) 162, 185, 197, 203, 218
MboII GAAGA 5 cut(s) 97, 134, 161, 195, 257
MflI RGATCY 1 cut(s) 185
MluCI AATT 1 cut(s) 262
MnlI CCTC 7 cut(s) 121, 148, 189, 224, 235, 237, 241
MspI CCGG 1 cut(s) 95
NdeII GATC 5 cut(s) 162, 185, 197, 203, 218
NheI GCTAGC 1 cut(s) 251
PaeR7I CTCGAG 1 cut(s) 228
PcsI WCGNNNNNNNCGW 1 cut(s) 214
PfeI GAWTC 1 cut(s) 223
Ple19I CGATCG 1 cut(s) 221
PpuMI RGGWCCY 1 cut(s) 176
Psp5II RGGWCCY 1 cut(s) 176
PspPI GGNCC 1 cut(s) 176
PspPPI RGGWCCY 1 cut(s) 176
PspXI VCTCGAGB 1 cut(s) 228
PsuI RGATCY 1 cut(s) 185
PvuI CGATCG 1 cut(s) 221
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SalI GTCGAC 1 cut(s) 40
Sau3AI GATC 5 cut(s) 162, 185, 197, 203, 218
Sau96I GGNCC 1 cut(s) 176
SetI ASST 4 cut(s) 72, 115, 181, 257
Sfr274I CTCGAG 1 cut(s) 228
SgrAI CRCCGGYG 1 cut(s) 94
SgrDI CGTCGACG 1 cut(s) 40
SinI GGWCC 1 cut(s) 176
SlaI CTCGAG 1 cut(s) 228
SmlI CTYRAG 1 cut(s) 228
SmoI CTYRAG 1 cut(s) 228
Sse9I AATT 1 cut(s) 262
SsiI CCGC 1 cut(s) 107
SspI AATATT 1 cut(s) 79
SspMI CTAG 2 cut(s) 71, 252
TaqI TCGA 6 cut(s) 41, 165, 181, 208, 221, 229
TasI AATT 1 cut(s) 262
TatI WGTACW 1 cut(s) 18
TfiI GAWTC 1 cut(s) 223
TscAI CASTG 1 cut(s) 53
TspGWI ACGGA 1 cut(s) 48
TspRI CASTG 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 176
XhoI CTCGAG 1 cut(s) 228
XmiI GTMKAC 1 cut(s) 41
XspI CTAG 2 cut(s) 71, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.