Rorug03G0158900

Phosducin-like protein 3

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0002093
Physical Location & Seq
Forward (+)
13149618 .. 13150022
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0158900.1

Sequence Viewer

Length: 405 bp
ATGGTTGCTAGTGGAGGGCAGCCTTTGGTTGGTTTAATTTCGCCAGAACATGCAGAGGTTTTGGCATGCAAGATGGCAATTGACTTTGCCTTAGACCAAAGTTTGTTATCTGTTGTGATAGAGACTGATTTTGAGATGGTGCAACGACAACTTTGCAACTTTGAAGAGATTAATACTTTCTTTTTGGGTCGTATGTATGAAGACTTGAGTTGCATATTGGCATCAAATCTCAATTTTCAAATTTCTCACACTAGAAGCAATGCTAACAAGTTAGCACATTTAATGGCTGCTCATGCTAGCTCTCTAGTGCATGAATGCTTTTATTTTTCTTCTCATTCTTTATTATTAGCTGCTATTGCAGCTCAACGTTATCATATGTTTGGAAAATTATTCTTAATAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Phosducin

Protein Analysis

134

Amino Acids

14.94

Weight (kDa)

5.71

Isoelectric Point (pI)

48.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 7 - 99 2e-12 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 367
AcsI RAATTY 1 cut(s) 240
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 2 cut(s) 164, 239
AluBI AGCT 3 cut(s) 300, 350, 362
AluI AGCT 3 cut(s) 300, 350, 362
Alw26I GTCTC 1 cut(s) 116
ApeKI GCWGC 4 cut(s) 19, 287, 350, 359
ApoI RAATTY 1 cut(s) 240
AseI ATTAAT 1 cut(s) 171
AsuNHI GCTAGC 1 cut(s) 296
BbsI GAAGAC 1 cut(s) 207
BbvI GCAGC 4 cut(s) 31, 274, 337, 371
BccI CCATC 2 cut(s) 67, 130
BcgI CGANNNNNNTGC 2 cut(s) 135, 169
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 4 cut(s) 9, 252, 297, 305
BisI GCNGC 4 cut(s) 20, 288, 351, 360
BlsI GCNGC 4 cut(s) 21, 289, 352, 361
BmsI GCATC 1 cut(s) 230
BmtI GCTAGC 1 cut(s) 300
BpiI GAAGAC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse3DI GCAATG 1 cut(s) 265
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 265
BseXI GCAGC 4 cut(s) 31, 274, 337, 371
BslI CCNNNNNNNGG 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 320
BspOI GCTAGC 1 cut(s) 300
BsrDI GCAATG 1 cut(s) 265
Bst6I CTCTTC 1 cut(s) 159
BstC8I GCNNGC 2 cut(s) 67, 298
BstDEI CTNAG 1 cut(s) 91
BstMAI GTCTC 1 cut(s) 116
BstMWI GCNNNNNNNGC 3 cut(s) 293, 356, 359
BstNSI RCATGY 2 cut(s) 53, 69
BstV1I GCAGC 4 cut(s) 31, 274, 337, 371
BstV2I GAAGAC 1 cut(s) 207
Cac8I GCNNGC 2 cut(s) 67, 298
CviAII CATG 4 cut(s) 50, 66, 293, 311
CviJI RGCY 5 cut(s) 22, 287, 300, 350, 362
CviKI_1 RGCY 5 cut(s) 22, 287, 300, 350, 362
DdeI CTNAG 1 cut(s) 91
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
FaeI CATG 4 cut(s) 53, 69, 296, 314
FaiI YATR 9 cut(s) 51, 67, 194, 198, 215, 294, 312, 375, 377
FatI CATG 4 cut(s) 49, 65, 292, 310
FauNDI CATATG 1 cut(s) 375
Fnu4HI GCNGC 4 cut(s) 20, 288, 351, 360
Fsp4HI GCNGC 4 cut(s) 20, 288, 351, 360
FspBI CTAG 4 cut(s) 9, 252, 297, 305
GluI GCNGC 4 cut(s) 20, 288, 351, 360
Hin1II CATG 4 cut(s) 53, 69, 296, 314
HpyCH4IV ACGT 1 cut(s) 367
HpyCH4V TGCA 7 cut(s) 53, 69, 142, 156, 213, 310, 359
HpyF10VI GCNNNNNNNGC 3 cut(s) 293, 356, 359
HpyF3I CTNAG 1 cut(s) 91
HpySE526I ACGT 1 cut(s) 367
Hsp92II CATG 4 cut(s) 53, 69, 296, 314
LpnPI CCDG 1 cut(s) 57
Lsp1109I GCAGC 4 cut(s) 31, 274, 337, 371
LweI GCATC 1 cut(s) 230
MaeI CTAG 4 cut(s) 9, 252, 297, 305
MaeII ACGT 1 cut(s) 367
MboII GAAGA 3 cut(s) 176, 212, 321
MfeI CAATTG 1 cut(s) 78
MluCI AATT 5 cut(s) 36, 78, 232, 240, 386
MnlI CCTC 2 cut(s) 8, 49
MseI TTAA 4 cut(s) 35, 171, 281, 395
MunI CAATTG 1 cut(s) 78
Mva1269I GAATGC 1 cut(s) 320
MwoI GCNNNNNNNGC 3 cut(s) 293, 356, 359
NdeI CATATG 1 cut(s) 375
NheI GCTAGC 1 cut(s) 296
NlaIII CATG 4 cut(s) 53, 69, 296, 314
NspI RCATGY 2 cut(s) 53, 69
PaeI GCATGC 1 cut(s) 69
PctI GAATGC 1 cut(s) 320
PkrI GCNGC 4 cut(s) 21, 289, 352, 361
PshBI ATTAAT 1 cut(s) 171
Psp1406I AACGTT 1 cut(s) 367
SaqAI TTAA 4 cut(s) 35, 171, 281, 395
SatI GCNGC 4 cut(s) 20, 288, 351, 360
SetI ASST 5 cut(s) 60, 302, 352, 364, 370
SfaNI GCATC 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 205
SmoI CTYRAG 1 cut(s) 205
SphI GCATGC 1 cut(s) 69
Sse9I AATT 5 cut(s) 36, 78, 232, 240, 386
SspMI CTAG 4 cut(s) 9, 252, 297, 305
TaiI ACGT 1 cut(s) 370
TasI AATT 5 cut(s) 36, 78, 232, 240, 386
Tru1I TTAA 4 cut(s) 35, 171, 281, 395
Tru9I TTAA 4 cut(s) 35, 171, 281, 395
TseI GCWGC 4 cut(s) 19, 287, 350, 359
TspDTI ATGAA 2 cut(s) 213, 327
VspI ATTAAT 1 cut(s) 171
XapI RAATTY 1 cut(s) 240
XceI RCATGY 2 cut(s) 53, 69
XspI CTAG 4 cut(s) 9, 252, 297, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.