RchiOBHm_Chr1g0315561

Protein of unknown function, DUF547

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001176
Physical Location & Seq
Forward (+)
2639913 .. 2644697
4785 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54607

Sequence Viewer

Length: 381 bp
ATGATGTGTGACTCACCGATTGTGCAAACTAAGTTGAGCCAAAGTGATTCTCTCTGTAAATATTCTCATTCTAGCATCTCATGTGATTCTGAATTTCAGTCAGAGGTTGTGAAAGATGACTCGTTGTCAAAGGTACAAAGATTGGAACGGCAGCTGCTTGAAGAAATAGAGCTACGTGCTATTCTGGAAAATGCAATTGAGAAAAATGCTACTCAATTCTCCAGTCCAGCATGCCTTCCTTACAATGCTCAAGAGATCCTAAGCATTATTGCTGCAGTGGAGGTGACAGTTTCCGAACTAGAACAGGATCGGAGTTGGTTGCATTGCATTTCCAACCAAGTCAAGAAAGAAATAAAAGAAGGCTGGCAGAATATCGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF547 Lzipper-MIP1

Protein Analysis

126

Amino Acids

14.28

Weight (kDa)

4.71

Isoelectric Point (pI)

78.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lzipper-MIP1 PF14389 40 - 108 1e-12 Leucine-zipper of ternary complex factor MIP1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 250, 315
AcsI RAATTY 1 cut(s) 92
AfaI GTAC 1 cut(s) 135
AgsI TTSAA 1 cut(s) 161
AhdI GACNNNNNGTC 1 cut(s) 124
AluBI AGCT 2 cut(s) 154, 172
AluI AGCT 2 cut(s) 154, 172
AlwI GGATC 2 cut(s) 250, 315
ApeKI GCWGC 3 cut(s) 151, 154, 272
ApoI RAATTY 1 cut(s) 92
AsuHPI GGTGA 2 cut(s) 6, 295
BbvI GCAGC 3 cut(s) 141, 163, 259
BceAI ACGGC 1 cut(s) 164
BfaI CTAG 2 cut(s) 72, 299
BfmI CTRYAG 1 cut(s) 273
BisI GCNGC 3 cut(s) 152, 155, 273
BlsI GCNGC 3 cut(s) 153, 156, 274
BmeRI GACNNNNNGTC 1 cut(s) 124
BmsI GCATC 1 cut(s) 84
BpmI CTGGAG 1 cut(s) 205
Bpu10I CCTNAGC 1 cut(s) 260
BpuEI CTTGAG 1 cut(s) 234
BsaAI YACGTR 1 cut(s) 176
Bse1I ACTGG 1 cut(s) 222
Bse3DI GCAATG 1 cut(s) 322
BseMI GCAATG 1 cut(s) 322
BseNI ACTGG 1 cut(s) 222
BseXI GCAGC 3 cut(s) 141, 163, 259
Bsp143I GATC 2 cut(s) 255, 307
BspMAI CTGCAG 1 cut(s) 277
BspPI GGATC 2 cut(s) 250, 315
BsrDI GCAATG 1 cut(s) 322
BsrI ACTGG 1 cut(s) 222
BssMI GATC 2 cut(s) 255, 307
Bst4CI ACNGT 1 cut(s) 289
BstBAI YACGTR 1 cut(s) 176
BstC8I GCNNGC 2 cut(s) 232, 365
BstDEI CTNAG 2 cut(s) 30, 260
BstKTI GATC 2 cut(s) 258, 310
BstMBI GATC 2 cut(s) 255, 307
BstNSI RCATGY 1 cut(s) 234
BstSFI CTRYAG 1 cut(s) 273
BstV1I GCAGC 3 cut(s) 141, 163, 259
BstX2I RGATCY 1 cut(s) 255
BstYI RGATCY 1 cut(s) 255
BtsI GCAGTG 1 cut(s) 282
BtsIMutI CAGTG 1 cut(s) 282
Cac8I GCNNGC 2 cut(s) 232, 365
Csp6I GTAC 1 cut(s) 134
CviAII CATG 2 cut(s) 81, 231
CviJI RGCY 4 cut(s) 39, 154, 172, 363
CviKI_1 RGCY 4 cut(s) 39, 154, 172, 363
CviQI GTAC 1 cut(s) 134
DdeI CTNAG 2 cut(s) 30, 260
DpnI GATC 2 cut(s) 257, 309
DpnII GATC 2 cut(s) 255, 307
DriI GACNNNNNGTC 1 cut(s) 124
Eam1105I GACNNNNNGTC 1 cut(s) 124
FaeI CATG 2 cut(s) 84, 234
FaiI YATR 2 cut(s) 82, 232
FatI CATG 2 cut(s) 80, 230
Fnu4HI GCNGC 3 cut(s) 152, 155, 273
Fsp4HI GCNGC 3 cut(s) 152, 155, 273
FspBI CTAG 2 cut(s) 72, 299
GluI GCNGC 3 cut(s) 152, 155, 273
GsuI CTGGAG 1 cut(s) 205
Hin1II CATG 2 cut(s) 84, 234
HinfI GANTC 4 cut(s) 11, 47, 86, 119
HphI GGTGA 2 cut(s) 6, 295
Hpy188I TCNGA 5 cut(s) 91, 103, 295, 312, 380
Hpy188III TCNNGA 3 cut(s) 185, 251, 343
HpyAV CCTTC 2 cut(s) 245, 353
HpyCH4III ACNGT 1 cut(s) 289
HpyCH4IV ACGT 1 cut(s) 175
HpyCH4V TGCA 5 cut(s) 25, 194, 275, 322, 327
HpyF3I CTNAG 2 cut(s) 30, 260
HpySE526I ACGT 1 cut(s) 175
Hsp92II CATG 2 cut(s) 84, 234
Kzo9I GATC 2 cut(s) 255, 307
LpnPI CCDG 5 cut(s) 170, 235, 240, 290, 349
Lsp1109I GCAGC 3 cut(s) 141, 163, 259
LweI GCATC 1 cut(s) 84
MaeI CTAG 2 cut(s) 72, 299
MaeII ACGT 1 cut(s) 175
MaeIII GTNAC 2 cut(s) 8, 283
MalI GATC 2 cut(s) 257, 309
MboI GATC 2 cut(s) 255, 307
MboII GAAGA 1 cut(s) 173
MfeI CAATTG 1 cut(s) 195
MflI RGATCY 1 cut(s) 255
MluCI AATT 3 cut(s) 92, 195, 215
MlyI GAGTC 2 cut(s) 5, 113
MmeI TCCRAC 1 cut(s) 357
MnlI CCTC 2 cut(s) 97, 274
MspA1I CMGCKG 1 cut(s) 154
MunI CAATTG 1 cut(s) 195
NdeII GATC 2 cut(s) 255, 307
NlaIII CATG 2 cut(s) 84, 234
NmuCI GTSAC 2 cut(s) 8, 283
NspI RCATGY 1 cut(s) 234
PaeI GCATGC 1 cut(s) 234
PfeI GAWTC 2 cut(s) 47, 86
PkrI GCNGC 3 cut(s) 153, 156, 274
PleI GAGTC 2 cut(s) 5, 113
PpsI GAGTC 2 cut(s) 5, 113
Ppu21I YACGTR 1 cut(s) 176
PstI CTGCAG 1 cut(s) 277
PsuI RGATCY 1 cut(s) 255
PvuII CAGCTG 1 cut(s) 154
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
SatI GCNGC 3 cut(s) 152, 155, 273
Sau3AI GATC 2 cut(s) 255, 307
SchI GAGTC 2 cut(s) 5, 113
SetI ASST 6 cut(s) 108, 135, 156, 174, 178, 285
SfaNI GCATC 1 cut(s) 84
SfcI CTRYAG 1 cut(s) 273
SmlI CTYRAG 1 cut(s) 249
SmoI CTYRAG 1 cut(s) 249
SphI GCATGC 1 cut(s) 234
Sse9I AATT 3 cut(s) 92, 195, 215
SspI AATATT 1 cut(s) 62
SspMI CTAG 2 cut(s) 72, 299
TaaI ACNGT 1 cut(s) 289
TaiI ACGT 1 cut(s) 178
TasI AATT 3 cut(s) 92, 195, 215
TfiI GAWTC 2 cut(s) 47, 86
TscAI CASTG 1 cut(s) 282
TseFI GTSAC 2 cut(s) 8, 283
TseI GCWGC 3 cut(s) 151, 154, 272
Tsp45I GTSAC 2 cut(s) 8, 283
TspRI CASTG 1 cut(s) 282
XapI RAATTY 1 cut(s) 92
XceI RCATGY 1 cut(s) 234
XspI CTAG 2 cut(s) 72, 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.