RchiOBHm_Chr5g0049331

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001176
Physical Location & Seq
Reverse (-)
46883753 .. 46885470
1718 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32700

Sequence Viewer

Length: 177 bp
ATGGGTTTGGGAGTTGTGAAAGCTTGTCTGTACCTGCGTATAGCTTCTGGTCTTCTAGTACCAGAAGCCAAGCTGTTTCTGCATTTGGAGGATTTGCTTTATGTGGATAAAGCCAAACCCCATGATCGCAGGACGATGTGTGACTCACCGATTGTGCAAGCTAAGTTGAGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.47

Weight (kDa)

9.1

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 42
AfaI GTAC 2 cut(s) 32, 60
AluBI AGCT 4 cut(s) 23, 44, 73, 161
AluI AGCT 4 cut(s) 23, 44, 73, 161
AsuHPI GGTGA 1 cut(s) 138
BbsI GAAGAC 1 cut(s) 44
BfaI CTAG 1 cut(s) 56
BfuAI ACCTGC 1 cut(s) 42
BpiI GAAGAC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 124
BspMI ACCTGC 1 cut(s) 42
BssMI GATC 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 162
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstV2I GAAGAC 1 cut(s) 44
BveI ACCTGC 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 159
Csp6I GTAC 2 cut(s) 31, 59
CviAII CATG 1 cut(s) 122
CviJI RGCY 6 cut(s) 23, 44, 68, 73, 113, 161
CviKI_1 RGCY 6 cut(s) 23, 44, 68, 73, 113, 161
CviQI GTAC 2 cut(s) 31, 59
DdeI CTNAG 1 cut(s) 162
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
FaeI CATG 1 cut(s) 125
FaiI YATR 3 cut(s) 41, 102, 123
FatI CATG 1 cut(s) 121
FspBI CTAG 1 cut(s) 56
Hin1II CATG 1 cut(s) 125
HindIII AAGCTT 1 cut(s) 21
HinfI GANTC 1 cut(s) 143
HphI GGTGA 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 82, 157
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 1 cut(s) 125
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 4 cut(s) 33, 47, 75, 115
MaeI CTAG 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 140
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 44
MlyI GAGTC 1 cut(s) 137
MnlI CCTC 1 cut(s) 82
MwoI GCNNNNNNNGC 1 cut(s) 79
NdeII GATC 1 cut(s) 124
NlaIII CATG 1 cut(s) 125
NmuCI GTSAC 1 cut(s) 140
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
RsaI GTAC 2 cut(s) 32, 60
RsaNI GTAC 2 cut(s) 31, 59
Sau3AI GATC 1 cut(s) 124
SchI GAGTC 1 cut(s) 137
SetI ASST 5 cut(s) 25, 36, 46, 75, 163
SgeI CNNG 9 cut(s) 36, 46, 60, 68, 74, 82, 134, 142, 170
SspMI CTAG 1 cut(s) 56
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.