RchiOBHm_Chr2g0102421

Belongs to the UDP-glycosyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0000822
Physical Location & Seq
Reverse (-)
13868117 .. 13868335
219 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47686

Sequence Viewer

Length: 219 bp
ATGATCAACTTTCGTCATCGTCGCCCCACCATGCTCATCGTGGACCTATTCGGCATCGAATCTTTGCCCATTGCCGAGGAGTTTGGGATTCCAAAGTATGTGTACATTGCTTCCAATGCATGGTTCCTTTCTGTAATGATTTATTCTCCAACACTAGATGAGCAAGTCAAGGGTAAATTTGTTGACCTCGAAGATCCACTAGAAATTCCTGGATGTTGA

Protein Analysis

72

Amino Acids

8.28

Weight (kDa)

4.68

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 120
AclWI GGATC 1 cut(s) 188
AcsI RAATTY 2 cut(s) 176, 204
AfaI GTAC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 120
AjnI CCWGG 1 cut(s) 208
AjuI GAANNNNNNNTTGG 2 cut(s) 107, 139
AlwI GGATC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 176, 204
AspS9I GGNCC 1 cut(s) 43
AvaII GGWCC 1 cut(s) 43
BciT130I CCWGG 1 cut(s) 210
BclI TGATCA 1 cut(s) 3
BfaI CTAG 2 cut(s) 155, 200
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 43
BmgT120I GGNCC 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 210
BmsI GCATC 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 120
Bse3DI GCAATG 2 cut(s) 69, 105
BseBI CCWGG 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 218
BseLI CCNNNNNNNGG 1 cut(s) 120
BseMI GCAATG 2 cut(s) 69, 105
BseRI GAGGAG 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 120
Bsp1407I TGTACA 1 cut(s) 102
Bsp143I GATC 2 cut(s) 3, 193
BspLI GGNNCC 1 cut(s) 125
BspPI GGATC 1 cut(s) 188
BsrDI GCAATG 2 cut(s) 69, 105
BsrGI TGTACA 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 75
BssMI GATC 2 cut(s) 3, 193
Bst2UI CCWGG 1 cut(s) 210
BstAUI TGTACA 1 cut(s) 102
BstF5I GGATG 1 cut(s) 218
BstKTI GATC 2 cut(s) 6, 196
BstMBI GATC 2 cut(s) 3, 193
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstX2I RGATCY 1 cut(s) 193
BstYI RGATCY 1 cut(s) 193
BtsCI GGATG 1 cut(s) 218
Cfr13I GGNCC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 31, 120
CviQI GTAC 1 cut(s) 103
DpnI GATC 2 cut(s) 5, 195
DpnII GATC 2 cut(s) 3, 193
Eco47I GGWCC 1 cut(s) 43
EcoRII CCWGG 1 cut(s) 208
EcoT22I ATGCAT 1 cut(s) 121
FaeI CATG 2 cut(s) 34, 123
FaiI YATR 3 cut(s) 32, 99, 121
FatI CATG 2 cut(s) 30, 119
FbaI TGATCA 1 cut(s) 3
FspBI CTAG 2 cut(s) 155, 200
Hin1II CATG 2 cut(s) 34, 123
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HinfI GANTC 2 cut(s) 59, 88
Hpy166II GTNNAC 3 cut(s) 43, 103, 184
Hpy8I GTNNAC 3 cut(s) 43, 103, 184
Hpy99I CGWCG 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
Hsp92II CATG 2 cut(s) 34, 123
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 193
LpnPI CCDG 1 cut(s) 195
LweI GCATC 1 cut(s) 63
MaeI CTAG 2 cut(s) 155, 200
MalI GATC 2 cut(s) 5, 195
MboI GATC 2 cut(s) 3, 193
MboII GAAGA 1 cut(s) 203
MflI RGATCY 1 cut(s) 193
MluCI AATT 2 cut(s) 176, 204
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 2 cut(s) 70, 197
Mph1103I ATGCAT 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 116
NdeII GATC 2 cut(s) 3, 193
NlaIII CATG 2 cut(s) 34, 123
NlaIV GGNNCC 1 cut(s) 125
NmeAIII GCCGAG 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 121
PfeI GAWTC 2 cut(s) 59, 88
PflMI CCANNNNNTGG 1 cut(s) 120
PfoI TCCNGGA 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 125
PspPI GGNCC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 193
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
Sau3AI GATC 2 cut(s) 3, 193
Sau96I GGNCC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 210
SetI ASST 2 cut(s) 48, 189
SfaNI GCATC 1 cut(s) 63
SgeI CNNG 9 cut(s) 43, 52, 88, 132, 167, 176, 181, 200, 212
SinI GGWCC 1 cut(s) 43
Sse9I AATT 2 cut(s) 176, 204
SspMI CTAG 2 cut(s) 155, 200
StyD4I CCNGG 1 cut(s) 208
TaqI TCGA 2 cut(s) 57, 189
TasI AATT 2 cut(s) 176, 204
TatI WGTACW 1 cut(s) 102
TfiI GAWTC 2 cut(s) 59, 88
Van91I CCANNNNNTGG 1 cut(s) 120
VpaK11BI GGWCC 1 cut(s) 43
XapI RAATTY 2 cut(s) 176, 204
XcmI CCANNNNNNNNNTGG 1 cut(s) 37
XspI CTAG 2 cut(s) 155, 200
Zsp2I ATGCAT 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.