RchiOBHm_Chr2g0136661

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
53975031 .. 53975399
369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50744

Sequence Viewer

Length: 159 bp
ATGCAATACATCAATTTCCCAACCGCCATCCACCCTTGTGTCGTCCCTAGAAGATTGCTTGCTTTCAAGGATCTTCAAGTTCTTCGTCTCAAGGCTTTATCATTCATCTTTCAAGGTGTATTATATCCTTTCTCTTGTTTTCTTTGTTTGATTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.06

Weight (kDa)

9.42

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 78
AgsI TTSAA 3 cut(s) 67, 77, 113
AleI CACNNNNGTG 1 cut(s) 36
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 1 cut(s) 78
BccI CCATC 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 74
BseGI GGATG 1 cut(s) 27
BslFI GGGAC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 92
BsmBI CGTCTC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 70
BspACI CCGC 1 cut(s) 24
BspPI GGATC 1 cut(s) 78
BssMI GATC 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 60
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BtsCI GGATG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 60
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Esp3I CGTCTC 1 cut(s) 92
FaiI YATR 1 cut(s) 124
FaqI GGGAC 1 cut(s) 29
FokI GGATG 1 cut(s) 14
FspBI CTAG 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 63, 65, 74
MflI RGATCY 1 cut(s) 70
MluCI AATT 1 cut(s) 13
MslI CAYNNNNRTG 1 cut(s) 36
NdeII GATC 1 cut(s) 70
OliI CACNNNNGTG 1 cut(s) 36
PsuI RGATCY 1 cut(s) 70
RseI CAYNNNNRTG 1 cut(s) 36
Sau3AI GATC 1 cut(s) 70
SetI ASST 1 cut(s) 118
SgeI CNNG 8 cut(s) 48, 60, 71, 79, 89, 103, 125, 147
SmiMI CAYNNNNRTG 1 cut(s) 36
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 13
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 48
TasI AATT 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 94
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.