Rroxscaffold_4G00322660

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
53070758 .. 53077824
7067 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00322660.1

Sequence Viewer

Length: 177 bp
ATGCAATACATCAATTTCCTAGCCGTCATCCACCCTTGTGTCGTCCCTAGAAGATTGCTTGCTTTCAAGGATCTTCAAGTTCTTCGTCTCAAGGCTTTATCATTCATCTTTCAAGAAAATCAAAAAAATCAGAAAATGGCTGCAGCTGCCCTCCCCGAACGGAAATCGCTGCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.71

Weight (kDa)

10.29

Isoelectric Point (pI)

37.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 78
AgsI TTSAA 3 cut(s) 67, 77, 113
AleI CACNNNNGTG 1 cut(s) 36
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 1 cut(s) 78
ApeKI GCWGC 4 cut(s) 140, 143, 146, 169
BbvI GCAGC 4 cut(s) 127, 133, 155, 156
BceAI ACGGC 1 cut(s) 8
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 2 cut(s) 20, 48
BfmI CTRYAG 1 cut(s) 141
BisI GCNGC 4 cut(s) 141, 144, 147, 170
BlsI GCNGC 4 cut(s) 142, 145, 148, 171
BpuEI CTTGAG 1 cut(s) 74
BseGI GGATG 1 cut(s) 27
BseXI GCAGC 4 cut(s) 127, 133, 155, 156
BslFI GGGAC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 92
BsmBI CGTCTC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 70
BspMAI CTGCAG 1 cut(s) 145
BspPI GGATC 1 cut(s) 78
BssMI GATC 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstSFI CTRYAG 1 cut(s) 141
BstV1I GCAGC 4 cut(s) 127, 133, 155, 156
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BtsCI GGATG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 60
CviJI RGCY 4 cut(s) 23, 95, 140, 146
CviKI_1 RGCY 4 cut(s) 23, 95, 140, 146
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Esp3I CGTCTC 1 cut(s) 92
FaqI GGGAC 1 cut(s) 29
Fnu4HI GCNGC 4 cut(s) 141, 144, 147, 170
FokI GGATG 1 cut(s) 14
Fsp4HI GCNGC 4 cut(s) 141, 144, 147, 170
FspBI CTAG 2 cut(s) 20, 48
GluI GCNGC 4 cut(s) 141, 144, 147, 170
Hpy188I TCNGA 1 cut(s) 132
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 4, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 174
Kzo9I GATC 1 cut(s) 70
Lsp1109I GCAGC 4 cut(s) 127, 133, 155, 156
MaeI CTAG 2 cut(s) 20, 48
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 63, 65, 74
MflI RGATCY 1 cut(s) 70
MluCI AATT 1 cut(s) 13
MnlI CCTC 1 cut(s) 161
MslI CAYNNNNRTG 1 cut(s) 36
MspA1I CMGCKG 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 146
NdeII GATC 1 cut(s) 70
OliI CACNNNNGTG 1 cut(s) 36
PkrI GCNGC 4 cut(s) 142, 145, 148, 171
PstI CTGCAG 1 cut(s) 145
PsuI RGATCY 1 cut(s) 70
PvuII CAGCTG 1 cut(s) 146
RseI CAYNNNNRTG 1 cut(s) 36
SatI GCNGC 4 cut(s) 141, 144, 147, 170
Sau3AI GATC 1 cut(s) 70
SetI ASST 1 cut(s) 148
SfcI CTRYAG 1 cut(s) 141
SgeI CNNG 9 cut(s) 32, 48, 60, 71, 79, 89, 103, 125, 167
SmiMI CAYNNNNRTG 1 cut(s) 36
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 13
SspMI CTAG 2 cut(s) 20, 48
TasI AATT 1 cut(s) 13
TseI GCWGC 4 cut(s) 140, 143, 146, 169
TspDTI ATGAA 1 cut(s) 94
TspGWI ACGGA 1 cut(s) 175
XspI CTAG 2 cut(s) 20, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.