Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0003963

Physical Location & Seq

Genomic Coordinates Forward (+)

29026226 .. 29037011

Gene Structure 10786 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00307600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 486 bp

ATGTGGTTGGCTGGAACTTGGCCCATTGTGGTGTATAACGGGTGCGGGAGGAGCGGTGGACTGGTCCAAACAAAGAAGATGGGCTTGAGTGATCTCTTTGAAAATCAAAAAAATCAGAAAATGGCTGCAGCTGCCCTCCCCGAACGGAAATCGCTGCCTTGGCTTCACGGCAACGAGACACCCAAAAAATGGTCGGATGCTCCGCCACGCGCTGTCGCCAATTGCTTGAGTGTAGGCTTCACGCGCCGTTGGCAACTCCCAAATTGGGTGAAGAGACCTATGCCAAAATGTTCACAACAACAAGCCCAACAACTTCTTCAACTAGCACAAAGTCCAGAAATGAAAGGATTAGCCGAAAATTACCTTGAAAGCTCAAGTACTCGTGAAACCCGATTTGCATTTTTTGATCAATTCTTCCTCCTCGCTGTGAATTGGTTCAAGCCAATTGGAGAGGATGATCAGCGTTTCCTAGGCTTCCATAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

161

Amino Acids

18.43

Weight (kDa)

9.67

Isoelectric Point (pI)

49.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003963)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0364461 RchiOBHm_Chr1g0367941 RchiOBHm_Chr2g0121191 RchiOBHm_Chr2g0122271 RchiOBHm_Chr2g0125931 RchiOBHm_Chr2g0136661 RchiOBHm_Chr2g0146691 RchiOBHm_Chr2g0155551 RchiOBHm_Chr3g0448751 RchiOBHm_Chr3g0470561 RchiOBHm_Chr4g0399811 RchiOBHm_Chr4g0411721 RchiOBHm_Chr4g0411851 RchiOBHm_Chr4g0412001 RchiOBHm_Chr7g0186941 RchiOBHm_Chr7g0188841
rosa_laevigata	RLG00000008312
rosa_multiflora	Rmu_sc0003541.1_g000003
rosa_roxburghii	Rroxscaffold_1G00009330 Rroxscaffold_2G00119730 Rroxscaffold_4G00292510 Rroxscaffold_4G00304910 Rroxscaffold_4G00307600 Rroxscaffold_4G00319210 Rroxscaffold_4G00320210 Rroxscaffold_4G00322660 Rroxscaffold_5G00351300 Rroxscaffold_5G00351690 Rroxscaffold_6G00390060 Rroxscaffold_7G00188640 Rroxscaffold_7G00192410
rosa_samantha	Rh4BG169300 Rh5DG553800
rosa_wichuraiana	Rw1G028780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	189
AccBSI	CCGCTC	1 cut(s)	54
AccII	CGCG	2 cut(s)	210, 244
AciI	CCGC	3 cut(s)	45, 54, 203
AfaI	GTAC	1 cut(s)	379
AfiI	CCNNNNNNNGG	2 cut(s)	189, 265
AgsI	TTSAA	4 cut(s)	101, 320, 368, 439
AjuI	GAANNNNNNNTTGG	2 cut(s)	300, 332
AluBI	AGCT	2 cut(s)	131, 372
AluI	AGCT	2 cut(s)	131, 372
Alw26I	GTCTC	2 cut(s)	170, 268
AoxI	GGCC	1 cut(s)	20
ApeKI	GCWGC	4 cut(s)	125, 128, 131, 154
Asp700I	GAANNNNTTC	1 cut(s)	434
AspA2I	CCTAGG	1 cut(s)	469
AspLEI	GCGC	2 cut(s)	212, 246
AspS9I	GGNCC	2 cut(s)	21, 64
AsuHPI	GGTGA	1 cut(s)	280
AvaII	GGWCC	1 cut(s)	64
AvrII	CCTAGG	1 cut(s)	469
BauI	CACGAG	1 cut(s)	381
BbvI	GCAGC	4 cut(s)	112, 118, 140, 141
BccI	CCATC	1 cut(s)	73
BceAI	ACGGC	2 cut(s)	184, 231
BclI	TGATCA	2 cut(s)	406, 457
BcoDI	GTCTC	2 cut(s)	170, 268
BfaI	CTAG	2 cut(s)	323, 470
BfmI	CTRYAG	1 cut(s)	126
BisI	GCNGC	4 cut(s)	126, 129, 132, 155
BlnI	CCTAGG	1 cut(s)	469
BlsI	GCNGC	4 cut(s)	127, 130, 133, 156
BmcAI	AGTACT	1 cut(s)	379
Bme18I	GGWCC	1 cut(s)	64
BmgT120I	GGNCC	2 cut(s)	21, 64
BmsI	GCATC	1 cut(s)	187
BpuEI	CTTGAG	3 cut(s)	106, 247, 358
BsaI	GGTCTC	1 cut(s)	268
BsaJI	CCNNGG	2 cut(s)	158, 469
BsaXI	ACNNNNNCTCC	2 cut(s)	40, 70
Bsc4I	CCNNNNNNNGG	2 cut(s)	189, 265
Bse1I	ACTGG	1 cut(s)	66
BseDI	CCNNGG	2 cut(s)	158, 469
BseGI	GGATG	2 cut(s)	202, 460
BseLI	CCNNNNNNNGG	2 cut(s)	189, 265
BseNI	ACTGG	1 cut(s)	66
BseRI	GAGGAG	2 cut(s)	64, 410
BseXI	GCAGC	4 cut(s)	112, 118, 140, 141
Bsh1236I	CGCG	2 cut(s)	210, 244
BshFI	GGCC	1 cut(s)	22
BslI	CCNNNNNNNGG	2 cut(s)	189, 265
BsmAI	GTCTC	2 cut(s)	170, 268
BsnI	GGCC	1 cut(s)	22
Bso31I	GGTCTC	1 cut(s)	268
Bsp143I	GATC	3 cut(s)	91, 406, 457
BspACI	CCGC	3 cut(s)	45, 54, 203
BspANI	GGCC	1 cut(s)	22
BspFNI	CGCG	2 cut(s)	210, 244
BspMAI	CTGCAG	1 cut(s)	130
BspTNI	GGTCTC	1 cut(s)	268
BsrBI	CCGCTC	1 cut(s)	54
BsrI	ACTGG	1 cut(s)	66
BssECI	CCNNGG	2 cut(s)	158, 469
BssMI	GATC	3 cut(s)	91, 406, 457
BssSI	CACGAG	1 cut(s)	381
BssT1I	CCWWGG	2 cut(s)	158, 469
Bst2BI	CACGAG	1 cut(s)	381
Bst6I	CTCTTC	1 cut(s)	266
BstF5I	GGATG	2 cut(s)	202, 460
BstFNI	CGCG	2 cut(s)	210, 244
BstHHI	GCGC	2 cut(s)	212, 246
BstKTI	GATC	3 cut(s)	94, 409, 460
BstMAI	GTCTC	2 cut(s)	170, 268
BstMBI	GATC	3 cut(s)	91, 406, 457
BstMWI	GCNNNNNNNGC	5 cut(s)	51, 131, 160, 243, 250
BstSFI	CTRYAG	1 cut(s)	126
BstUI	CGCG	2 cut(s)	210, 244
BstV1I	GCAGC	4 cut(s)	112, 118, 140, 141
BsuRI	GGCC	1 cut(s)	22
BtsCI	GGATG	2 cut(s)	202, 460
CfoI	GCGC	2 cut(s)	212, 246
Cfr13I	GGNCC	2 cut(s)	21, 64
Csp6I	GTAC	1 cut(s)	378
CviQI	GTAC	1 cut(s)	378
DpnI	GATC	3 cut(s)	93, 408, 459
DpnII	GATC	3 cut(s)	91, 406, 457
Eam1104I	CTCTTC	1 cut(s)	266
EarI	CTCTTC	1 cut(s)	266
EciI	GGCGGA	1 cut(s)	192
Eco130I	CCWWGG	2 cut(s)	158, 469
Eco31I	GGTCTC	1 cut(s)	268
Eco47I	GGWCC	1 cut(s)	64
EcoT14I	CCWWGG	2 cut(s)	158, 469
ErhI	CCWWGG	2 cut(s)	158, 469
FaiI	YATR	3 cut(s)	36, 281, 480
FalI	AAGNNNNNCTT	2 cut(s)	68, 100
FauI	CCCGC	1 cut(s)	38
FbaI	TGATCA	2 cut(s)	406, 457
Fnu4HI	GCNGC	4 cut(s)	126, 129, 132, 155
FokI	GGATG	2 cut(s)	209, 467
Fsp4HI	GCNGC	4 cut(s)	126, 129, 132, 155
FspBI	CTAG	2 cut(s)	323, 470
GlaI	GCGC	2 cut(s)	211, 245
GluI	GCNGC	4 cut(s)	126, 129, 132, 155
HaeIII	GGCC	1 cut(s)	22
HhaI	GCGC	2 cut(s)	212, 246
Hin6I	GCGC	2 cut(s)	210, 244
HinP1I	GCGC	2 cut(s)	210, 244
HphI	GGTGA	1 cut(s)	280
Hpy166II	GTNNAC	2 cut(s)	59, 293
Hpy188I	TCNGA	2 cut(s)	117, 196
Hpy188III	TCNNGA	2 cut(s)	335, 383
Hpy8I	GTNNAC	2 cut(s)	59, 293
HpyCH4V	TGCA	2 cut(s)	128, 398
HpyF10VI	GCNNNNNNNGC	5 cut(s)	51, 131, 160, 243, 250
HspAI	GCGC	2 cut(s)	210, 244
Ksp22I	TGATCA	2 cut(s)	406, 457
Kzo9I	GATC	3 cut(s)	91, 406, 457
LmnI	GCTCC	2 cut(s)	51, 205
LpnPI	CCDG	2 cut(s)	47, 348
Lsp1109I	GCAGC	4 cut(s)	112, 118, 140, 141
LweI	GCATC	1 cut(s)	187
MaeI	CTAG	2 cut(s)	323, 470
MalI	GATC	3 cut(s)	93, 408, 459
MbiI	CCGCTC	1 cut(s)	54
MboI	GATC	3 cut(s)	91, 406, 457
MboII	GAAGA	4 cut(s)	88, 283, 308, 406
MfeI	CAATTG	2 cut(s)	220, 444
MluCI	AATT	6 cut(s)	220, 262, 358, 410, 430, 444
MmeI	TCCRAC	1 cut(s)	174
MnlI	CCTC	5 cut(s)	42, 146, 428, 431, 445
MroXI	GAANNNNTTC	1 cut(s)	434
MslI	CAYNNNNRTG	1 cut(s)	29
MspA1I	CMGCKG	1 cut(s)	131
MunI	CAATTG	2 cut(s)	220, 444
MvnI	CGCG	2 cut(s)	210, 244
MwoI	GCNNNNNNNGC	5 cut(s)	51, 131, 160, 243, 250
NdeII	GATC	3 cut(s)	91, 406, 457
PcsI	WCGNNNNNNNCGW	1 cut(s)	388
PdmI	GAANNNNTTC	1 cut(s)	434
PflMI	CCANNNNNTGG	1 cut(s)	189
PkrI	GCNGC	4 cut(s)	127, 130, 133, 156
PspPI	GGNCC	2 cut(s)	21, 64
PstI	CTGCAG	1 cut(s)	130
PvuII	CAGCTG	1 cut(s)	131
RsaI	GTAC	1 cut(s)	379
RsaNI	GTAC	1 cut(s)	378
RseI	CAYNNNNRTG	1 cut(s)	29
SatI	GCNGC	4 cut(s)	126, 129, 132, 155
Sau3AI	GATC	3 cut(s)	91, 406, 457
Sau96I	GGNCC	2 cut(s)	21, 64
ScaI	AGTACT	1 cut(s)	379
SetI	ASST	4 cut(s)	133, 280, 366, 374
SfaNI	GCATC	1 cut(s)	187
SfcI	CTRYAG	1 cut(s)	126
SinI	GGWCC	1 cut(s)	64
SmiMI	CAYNNNNRTG	1 cut(s)	29
SmlI	CTYRAG	3 cut(s)	85, 226, 373
SmoI	CTYRAG	3 cut(s)	85, 226, 373
Sse9I	AATT	6 cut(s)	220, 262, 358, 410, 430, 444
SsiI	CCGC	3 cut(s)	45, 54, 203
SspMI	CTAG	2 cut(s)	323, 470
StyI	CCWWGG	2 cut(s)	158, 469
TasI	AATT	6 cut(s)	220, 262, 358, 410, 430, 444
TatI	WGTACW	1 cut(s)	377
TseI	GCWGC	4 cut(s)	125, 128, 131, 154
TspDTI	ATGAA	1 cut(s)	356
TspGWI	ACGGA	1 cut(s)	160
Van91I	CCANNNNNTGG	1 cut(s)	189
VpaK11BI	GGWCC	1 cut(s)	64
XmaJI	CCTAGG	1 cut(s)	469
XmnI	GAANNNNTTC	1 cut(s)	434
XspI	CTAG	2 cut(s)	323, 470
ZrmI	AGTACT	1 cut(s)	379

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.