Rroxscaffold_1G00009330

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
11760535 .. 11765167
4633 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00009330.1

Sequence Viewer

Length: 204 bp
ATGAAGAGTGGTCGGCCTGAAGAAGAGGAAAACTCCGGTTTGACATCACGAAGCTGTATGCGGGATGTTAGCCAAAGGAGCATCATATCTTCATCACCATTTCATTCATCATCACCATCAAGAAGTTCATATCCATCCATTCCACCATCAAGGAGGATTCAAGGAGCATTGAAGGAGAAAAATGAAGGAGAAGCTACTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.36

Weight (kDa)

9.1

Isoelectric Point (pI)

117.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AcuI CTGAAG 1 cut(s) 39
AgsI TTSAA 2 cut(s) 161, 172
AluBI AGCT 2 cut(s) 54, 194
AluI AGCT 2 cut(s) 54, 194
AoxI GGCC 1 cut(s) 14
AsuHPI GGTGA 2 cut(s) 87, 105
BccI CCATC 3 cut(s) 124, 142, 154
BmsI GCATC 1 cut(s) 90
BplI GAGNNNNNCTC 2 cut(s) 17, 49
BsaWI WCCGGW 1 cut(s) 35
BseGI GGATG 2 cut(s) 70, 134
BshFI GGCC 1 cut(s) 16
BsiSI CCGG 1 cut(s) 36
BsnI GGCC 1 cut(s) 16
BspACI CCGC 1 cut(s) 61
BspANI GGCC 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 18
BstF5I GGATG 2 cut(s) 70, 134
BstMWI GCNNNNNNNGC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 2 cut(s) 70, 134
CviJI RGCY 4 cut(s) 16, 54, 72, 194
CviKI_1 RGCY 4 cut(s) 16, 54, 72, 194
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 39
FaiI YATR 3 cut(s) 59, 86, 130
FauI CCCGC 1 cut(s) 54
FokI GGATG 2 cut(s) 77, 121
HaeIII GGCC 1 cut(s) 16
HapII CCGG 1 cut(s) 36
HinfI GANTC 1 cut(s) 157
HpaII CCGG 1 cut(s) 36
HphI GGTGA 2 cut(s) 87, 105
Hpy188III TCNNGA 2 cut(s) 48, 120
HpyAV CCTTC 2 cut(s) 166, 179
HpyF10VI GCNNNNNNNGC 1 cut(s) 78
LmnI GCTCC 2 cut(s) 78, 164
LpnPI CCDG 2 cut(s) 30, 49
LweI GCATC 1 cut(s) 90
MboII GAAGA 4 cut(s) 16, 32, 35, 81
MnlI CCTC 2 cut(s) 19, 147
MspI CCGG 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 78
PfeI GAWTC 1 cut(s) 157
SetI ASST 2 cut(s) 56, 196
SfaNI GCATC 1 cut(s) 90
SgeI CNNG 7 cut(s) 29, 48, 60, 74, 132, 162, 173
SsiI CCGC 1 cut(s) 61
TfiI GAWTC 1 cut(s) 157
TspDTI ATGAA 6 cut(s) 17, 81, 92, 96, 117, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.