RchiOBHm_Chr3g0470561

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
16493437 .. 16493942
506 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43634

Sequence Viewer

Length: 156 bp
ATGAACGAATTACACCGTGAGTGGAGATGGAGATGGATAGCTAGATGGTTGGATCTTGAATCTTGGAAGCAAGCCTTCAAGGTGGATGATGGAGGATATGATCTTCACGGCTCCTTCTTCTTCTTCCTCTCCTTGCTTGAAAATGCAGAAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.35

Weight (kDa)

5.11

Isoelectric Point (pI)

47.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 60
AgsI TTSAA 3 cut(s) 59, 79, 140
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AlwI GGATC 1 cut(s) 60
BccI CCATC 4 cut(s) 21, 27, 39, 83
BceAI ACGGC 1 cut(s) 124
BfaI CTAG 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 112
BseGI GGATG 1 cut(s) 91
Bsp143I GATC 2 cut(s) 52, 100
BspLI GGNNCC 1 cut(s) 112
BspPI GGATC 1 cut(s) 60
BssMI GATC 2 cut(s) 52, 100
Bst4CI ACNGT 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 72
BstF5I GGATG 1 cut(s) 91
BstKTI GATC 2 cut(s) 55, 103
BstMBI GATC 2 cut(s) 52, 100
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
BtsCI GGATG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 72
CviJI RGCY 3 cut(s) 41, 74, 111
CviKI_1 RGCY 3 cut(s) 41, 74, 111
DpnI GATC 2 cut(s) 54, 102
DpnII GATC 2 cut(s) 52, 100
FaiI YATR 1 cut(s) 99
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FokI GGATG 1 cut(s) 98
FspBI CTAG 1 cut(s) 42
HinfI GANTC 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 56
HpyAV CCTTC 2 cut(s) 85, 124
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 146
Kzo9I GATC 2 cut(s) 52, 100
LmnI GCTCC 1 cut(s) 116
MaeI CTAG 1 cut(s) 42
MalI GATC 2 cut(s) 54, 102
MboI GATC 2 cut(s) 52, 100
MboII GAAGA 4 cut(s) 95, 109, 112, 115
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 30
MnlI CCTC 2 cut(s) 86, 137
MseI TTAA 1 cut(s) 154
NdeII GATC 2 cut(s) 52, 100
NlaIV GGNNCC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 59
PspN4I GGNNCC 1 cut(s) 112
PsuI RGATCY 1 cut(s) 52
SaqAI TTAA 1 cut(s) 154
Sau3AI GATC 2 cut(s) 52, 100
SetI ASST 2 cut(s) 43, 84
SgeI CNNG 9 cut(s) 29, 54, 68, 75, 83, 91, 119, 145, 149
Sse9I AATT 1 cut(s) 8
SspMI CTAG 1 cut(s) 42
TaaI ACNGT 1 cut(s) 17
TasI AATT 1 cut(s) 8
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 1 cut(s) 154
Tru9I TTAA 1 cut(s) 154
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.