Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0003963

Physical Location & Seq

Genomic Coordinates Reverse (-)

46770254 .. 46770527

Gene Structure 274 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00319210.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGCAATACATCAAGATCCTATCCGCCATCCACCCTTGTGTCGTCCCTATAAGATTGATTGCTTTCAAGGATCTTCAAGTTCTTCGTCTCAAGGCTTGTCATCCATCTTTCATGGTGTATTTCATACTTTCTTCTATTTTCCTTTGTTTGATTTGTAGAGTTATGAATTCTAGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

58

Amino Acids

6.69

Weight (kDa)

9.44

Isoelectric Point (pI)

41.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003963)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0364461 RchiOBHm_Chr1g0367941 RchiOBHm_Chr2g0121191 RchiOBHm_Chr2g0122271 RchiOBHm_Chr2g0125931 RchiOBHm_Chr2g0136661 RchiOBHm_Chr2g0146691 RchiOBHm_Chr2g0155551 RchiOBHm_Chr3g0448751 RchiOBHm_Chr3g0470561 RchiOBHm_Chr4g0399811 RchiOBHm_Chr4g0411721 RchiOBHm_Chr4g0411851 RchiOBHm_Chr4g0412001 RchiOBHm_Chr7g0186941 RchiOBHm_Chr7g0188841
rosa_laevigata	RLG00000008312
rosa_multiflora	Rmu_sc0003541.1_g000003
rosa_roxburghii	Rroxscaffold_1G00009330 Rroxscaffold_2G00119730 Rroxscaffold_4G00292510 Rroxscaffold_4G00304910 Rroxscaffold_4G00307600 Rroxscaffold_4G00319210 Rroxscaffold_4G00320210 Rroxscaffold_4G00322660 Rroxscaffold_5G00351300 Rroxscaffold_5G00351690 Rroxscaffold_6G00390060 Rroxscaffold_7G00188640 Rroxscaffold_7G00192410
rosa_samantha	Rh4BG169300 Rh5DG553800
rosa_wichuraiana	Rw1G028780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	24
AclWI	GGATC	2 cut(s)	10, 78
AcsI	RAATTY	1 cut(s)	166
AgsI	TTSAA	2 cut(s)	67, 77
AleI	CACNNNNGTG	1 cut(s)	36
Alw26I	GTCTC	1 cut(s)	92
AlwI	GGATC	2 cut(s)	10, 78
ApoI	RAATTY	1 cut(s)	166
BccI	CCATC	2 cut(s)	35, 112
BcoDI	GTCTC	1 cut(s)	92
BfaI	CTAG	1 cut(s)	171
BpuEI	CTTGAG	1 cut(s)	74
BseGI	GGATG	2 cut(s)	27, 100
BslFI	GGGAC	1 cut(s)	29
BsmAI	GTCTC	1 cut(s)	92
BsmBI	CGTCTC	1 cut(s)	92
BsmFI	GGGAC	1 cut(s)	29
Bsp143I	GATC	2 cut(s)	15, 70
BspACI	CCGC	1 cut(s)	24
BspPI	GGATC	2 cut(s)	10, 78
BssMI	GATC	2 cut(s)	15, 70
BstF5I	GGATG	2 cut(s)	27, 100
BstKTI	GATC	2 cut(s)	18, 73
BstMAI	GTCTC	1 cut(s)	92
BstMBI	GATC	2 cut(s)	15, 70
BstX2I	RGATCY	2 cut(s)	15, 70
BstYI	RGATCY	2 cut(s)	15, 70
BtsCI	GGATG	2 cut(s)	27, 100
CviAII	CATG	1 cut(s)	112
CviJI	RGCY	1 cut(s)	95
CviKI_1	RGCY	1 cut(s)	95
DpnI	GATC	2 cut(s)	17, 72
DpnII	GATC	2 cut(s)	15, 70
EciI	GGCGGA	1 cut(s)	13
EcoRI	GAATTC	1 cut(s)	166
Esp3I	CGTCTC	1 cut(s)	92
FaeI	CATG	1 cut(s)	115
FaiI	YATR	4 cut(s)	50, 113, 125, 164
FaqI	GGGAC	1 cut(s)	29
FatI	CATG	1 cut(s)	111
FokI	GGATG	2 cut(s)	14, 87
FspBI	CTAG	1 cut(s)	171
Hin1II	CATG	1 cut(s)	115
Hpy188III	TCNNGA	1 cut(s)	13
HpyCH4V	TGCA	1 cut(s)	4
Hsp92II	CATG	1 cut(s)	115
Kzo9I	GATC	2 cut(s)	15, 70
MaeI	CTAG	1 cut(s)	171
MalI	GATC	2 cut(s)	17, 72
MboI	GATC	2 cut(s)	15, 70
MboII	GAAGA	3 cut(s)	65, 74, 123
MflI	RGATCY	2 cut(s)	15, 70
MluCI	AATT	1 cut(s)	166
MseI	TTAA	1 cut(s)	175
MslI	CAYNNNNRTG	1 cut(s)	36
NdeII	GATC	2 cut(s)	15, 70
NlaIII	CATG	1 cut(s)	115
OliI	CACNNNNGTG	1 cut(s)	36
PsuI	RGATCY	2 cut(s)	15, 70
RseI	CAYNNNNRTG	1 cut(s)	36
SaqAI	TTAA	1 cut(s)	175
Sau3AI	GATC	2 cut(s)	15, 70
SgeI	CNNG	7 cut(s)	25, 48, 79, 89, 103, 108, 124
SmiMI	CAYNNNNRTG	1 cut(s)	36
SmlI	CTYRAG	1 cut(s)	89
SmoI	CTYRAG	1 cut(s)	89
Sse9I	AATT	1 cut(s)	166
SsiI	CCGC	1 cut(s)	24
SspMI	CTAG	1 cut(s)	171
TasI	AATT	1 cut(s)	166
Tru1I	TTAA	1 cut(s)	175
Tru9I	TTAA	1 cut(s)	175
TspDTI	ATGAA	2 cut(s)	100, 112
XapI	RAATTY	1 cut(s)	166
XspI	CTAG	1 cut(s)	171

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.