Rroxscaffold_2G00119730

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0003963
Physical Location & Seq
Forward (+)
51691267 .. 51693355
2089 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00119730.1

Sequence Viewer

Length: 186 bp
ATGCAATACATCAAGATCCTAGCCACCATCCACCCTTGTATCGTCCCTAGAAGATTGCTTGCTTTCAAGGATCTTCAAGTTTTTCGTCTCAAGGCTCTGTCATTCATTTTTCACGGTGTACCCTCAATTCCCGGCTTGGACAATCCCTACTTATTCGATATTGATAACTACATTTTGCAGGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.04

Weight (kDa)

8.98

Isoelectric Point (pI)

32.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 10, 78
AfaI GTAC 1 cut(s) 120
AgsI TTSAA 2 cut(s) 67, 77
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 2 cut(s) 10, 78
AsuC2I CCSGG 1 cut(s) 132
BaeI ACNNNNGTAYC 2 cut(s) 22, 55
BccI CCATC 1 cut(s) 35
BcnI CCSGG 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 2 cut(s) 20, 48
Bme1390I CCNGG 1 cut(s) 132
BmrFI CCNGG 1 cut(s) 132
BpuEI CTTGAG 1 cut(s) 74
BpuMI CCSGG 1 cut(s) 132
BseGI GGATG 1 cut(s) 27
BsiSI CCGG 1 cut(s) 132
BslFI GGGAC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 92
BsmBI CGTCTC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 15, 70
BspPI GGATC 2 cut(s) 10, 78
BssMI GATC 2 cut(s) 15, 70
Bst4CI ACNGT 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 60
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 2 cut(s) 18, 73
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 2 cut(s) 15, 70
BstSCI CCNGG 1 cut(s) 130
BstX2I RGATCY 2 cut(s) 15, 70
BstYI RGATCY 2 cut(s) 15, 70
BtsCI GGATG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 119
CviJI RGCY 3 cut(s) 23, 95, 135
CviKI_1 RGCY 3 cut(s) 23, 95, 135
CviQI GTAC 1 cut(s) 119
DpnI GATC 2 cut(s) 17, 72
DpnII GATC 2 cut(s) 15, 70
Esp3I CGTCTC 1 cut(s) 92
FaqI GGGAC 1 cut(s) 29
FokI GGATG 1 cut(s) 14
FspBI CTAG 2 cut(s) 20, 48
HapII CCGG 1 cut(s) 132
HpaII CCGG 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 4, 178
Kzo9I GATC 2 cut(s) 15, 70
LpnPI CCDG 2 cut(s) 145, 164
MaeI CTAG 2 cut(s) 20, 48
MalI GATC 2 cut(s) 17, 72
MboI GATC 2 cut(s) 15, 70
MboII GAAGA 2 cut(s) 63, 65
MflI RGATCY 2 cut(s) 15, 70
MluCI AATT 1 cut(s) 126
MnlI CCTC 1 cut(s) 133
MseI TTAA 1 cut(s) 184
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 132
NciI CCSGG 1 cut(s) 132
NdeII GATC 2 cut(s) 15, 70
PsuI RGATCY 2 cut(s) 15, 70
RsaI GTAC 1 cut(s) 120
RsaNI GTAC 1 cut(s) 119
SaqAI TTAA 1 cut(s) 184
Sau3AI GATC 2 cut(s) 15, 70
ScrFI CCNGG 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 126
SspMI CTAG 2 cut(s) 20, 48
StyD4I CCNGG 1 cut(s) 130
TaaI ACNGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 156
TasI AATT 1 cut(s) 126
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 94
XspI CTAG 2 cut(s) 20, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.