RchiOBHm_Chr2g0150881

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
68561477 .. 68561829
353 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52013

Sequence Viewer

Length: 225 bp
ATGGCAATTGCCTACATCTCTTGGAAAATAAAAAGACTTAATCAAAATCGCCAGTTTCTGGTTCTTGATCCTTGTAGTCTTCTACCCTTAGATCGAGATCTCCATCTTGATCTTCTTGTTCCATGTAATGTGCCTCCCTCGCTTCACGATACATCTTGTATGCGTTTGCAACATTCTGGGATGCAGTACACTTCTTTGCCCAATGTCCATTTAATCCACATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.54

Weight (kDa)

7.81

Isoelectric Point (pI)

41.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 58
AclWI GGATC 1 cut(s) 62
AfaI GTAC 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 58
AlwI GGATC 1 cut(s) 62
AlwNI CAGNNNCTG 1 cut(s) 58
BbsI GAAGAC 1 cut(s) 71
BccI CCATC 1 cut(s) 111
BglII AGATCT 1 cut(s) 97
BmsI GCATC 1 cut(s) 171
BpiI GAAGAC 1 cut(s) 71
BsaBI GATNNNNATC 2 cut(s) 96, 102
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 52
Bse8I GATNNNNATC 2 cut(s) 96, 102
BseGI GGATG 1 cut(s) 186
BseJI GATNNNNATC 2 cut(s) 96, 102
BseLI CCNNNNNNNGG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 58
Bsp143I GATC 4 cut(s) 67, 91, 97, 109
BspPI GGATC 1 cut(s) 62
BsrI ACTGG 1 cut(s) 52
BssMI GATC 4 cut(s) 67, 91, 97, 109
BstDEI CTNAG 1 cut(s) 88
BstF5I GGATG 1 cut(s) 186
BstKTI GATC 4 cut(s) 70, 94, 100, 112
BstMBI GATC 4 cut(s) 67, 91, 97, 109
BstMWI GCNNNNNNNGC 1 cut(s) 139
BstV2I GAAGAC 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
BtsCI GGATG 1 cut(s) 186
CaiI CAGNNNCTG 1 cut(s) 58
Csp6I GTAC 1 cut(s) 187
CviAII CATG 1 cut(s) 123
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 1 cut(s) 88
DpnI GATC 4 cut(s) 69, 93, 99, 111
DpnII GATC 4 cut(s) 67, 91, 97, 109
FaeI CATG 1 cut(s) 126
FaiI YATR 2 cut(s) 124, 161
FatI CATG 1 cut(s) 122
FokI GGATG 1 cut(s) 193
Hin1II CATG 1 cut(s) 126
Hpy166II GTNNAC 1 cut(s) 189
Hpy188I TCNGA 1 cut(s) 224
Hpy188III TCNNGA 4 cut(s) 65, 95, 107, 146
Hpy8I GTNNAC 1 cut(s) 189
HpyCH4V TGCA 2 cut(s) 169, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 139
HpyF3I CTNAG 1 cut(s) 88
Hsp92II CATG 1 cut(s) 126
Kzo9I GATC 4 cut(s) 67, 91, 97, 109
LpnPI CCDG 3 cut(s) 44, 65, 162
LweI GCATC 1 cut(s) 171
MalI GATC 4 cut(s) 69, 93, 99, 111
MboI GATC 4 cut(s) 67, 91, 97, 109
MboII GAAGA 2 cut(s) 71, 104
MfeI CAATTG 1 cut(s) 6
MflI RGATCY 1 cut(s) 97
MluCI AATT 1 cut(s) 6
MnlI CCTC 2 cut(s) 144, 148
MseI TTAA 2 cut(s) 39, 212
MunI CAATTG 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 139
NdeII GATC 4 cut(s) 67, 91, 97, 109
NlaIII CATG 1 cut(s) 126
PflMI CCANNNNNTGG 1 cut(s) 58
PstNI CAGNNNCTG 1 cut(s) 58
PsuI RGATCY 1 cut(s) 97
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SaqAI TTAA 2 cut(s) 39, 212
Sau3AI GATC 4 cut(s) 67, 91, 97, 109
SfaNI GCATC 1 cut(s) 171
Sse9I AATT 1 cut(s) 6
TaqI TCGA 1 cut(s) 94
TasI AATT 1 cut(s) 6
TatI WGTACW 1 cut(s) 186
Tru1I TTAA 2 cut(s) 39, 212
Tru9I TTAA 2 cut(s) 39, 212
Van91I CCANNNNNTGG 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.