Rh7DG068200

Protein Brevis radix-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
5243735 .. 5243950
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG068200.1

Sequence Viewer

Length: 216 bp
ATGGATTTGGGAGCAGATGCTGGAGTGGAGGCCAAAGATTGCATCAAGATCAAGGATATGGCATTGAAGGCCTCGGTAGCCTACAAAAATTGCAAGTGGTGTTCGAGGCTGTGCGGAGAACACCTGAATCGGAACTGTTCGGATTCTGATATATCATTGAAGTTCCACTGCTTGTACCAGAGGACTGGGAACTGGAATTCGACGCTGAGGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.03

Weight (kDa)

8.59

Isoelectric Point (pI)

13.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 114
AcsI RAATTY 1 cut(s) 196
AfaI GTAC 1 cut(s) 176
AgsI TTSAA 2 cut(s) 67, 160
AlwNI CAGNNNCTG 1 cut(s) 20
AoxI GGCC 2 cut(s) 30, 69
ApoI RAATTY 1 cut(s) 196
BbvCI CCTCAGC 1 cut(s) 206
BmrI ACTGGG 1 cut(s) 195
BmsI GCATC 2 cut(s) 7, 51
BmuI ACTGGG 1 cut(s) 195
BpmI CTGGAG 1 cut(s) 42
Bpu10I CCTNAGC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 72
Bse1I ACTGG 2 cut(s) 190, 197
BseDI CCNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 197
BseNI ACTGG 2 cut(s) 190, 197
BshFI GGCC 2 cut(s) 32, 71
BsnI GGCC 2 cut(s) 32, 71
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 1 cut(s) 114
BspANI GGCC 2 cut(s) 32, 71
BspCNI CTCAG 1 cut(s) 198
BsrI ACTGG 2 cut(s) 190, 197
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 206
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstMWI GCNNNNNNNGC 2 cut(s) 68, 77
BstXI CCANNNNNNTGG 1 cut(s) 185
BsuRI GGCC 2 cut(s) 32, 71
BtsI GCAGTG 1 cut(s) 166
BtsIMutI CAGTG 1 cut(s) 166
CaiI CAGNNNCTG 1 cut(s) 20
CseI GACGC 1 cut(s) 211
Csp6I GTAC 1 cut(s) 175
CviJI RGCY 4 cut(s) 32, 71, 80, 109
CviKI_1 RGCY 4 cut(s) 32, 71, 80, 109
CviQI GTAC 1 cut(s) 175
DdeI CTNAG 1 cut(s) 206
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
Eco147I AGGCCT 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 196
FaiI YATR 2 cut(s) 59, 152
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 2 cut(s) 32, 71
HgaI GACGC 1 cut(s) 211
HinfI GANTC 2 cut(s) 127, 143
Hpy188I TCNGA 3 cut(s) 132, 142, 148
Hpy188III TCNNGA 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 205
HpyAV CCTTC 1 cut(s) 61
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 2 cut(s) 42, 93
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 77
HpyF3I CTNAG 1 cut(s) 206
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 5 cut(s) 6, 137, 171, 178, 191
LweI GCATC 2 cut(s) 7, 51
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MluCI AATT 2 cut(s) 88, 196
MnlI CCTC 5 cut(s) 22, 82, 99, 174, 201
MwoI GCNNNNNNNGC 2 cut(s) 68, 77
NdeII GATC 1 cut(s) 48
PceI AGGCCT 1 cut(s) 71
PfeI GAWTC 2 cut(s) 127, 143
PstNI CAGNNNCTG 1 cut(s) 20
RsaI GTAC 1 cut(s) 176
RsaNI GTAC 1 cut(s) 175
Sau3AI GATC 1 cut(s) 48
SetI ASST 1 cut(s) 126
SfaNI GCATC 2 cut(s) 7, 51
Sse9I AATT 2 cut(s) 88, 196
SseBI AGGCCT 1 cut(s) 71
SsiI CCGC 1 cut(s) 114
StuI AGGCCT 1 cut(s) 71
TaaI ACNGT 1 cut(s) 137
TaqI TCGA 2 cut(s) 104, 200
TasI AATT 2 cut(s) 88, 196
TfiI GAWTC 2 cut(s) 127, 143
TscAI CASTG 1 cut(s) 173
TspRI CASTG 1 cut(s) 173
XapI RAATTY 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.