RchiOBHm_Chr7g0184561

Protein Brevis radix-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
5073399 .. 5073557
159 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16468

Sequence Viewer

Length: 159 bp
ATGGCATTGAAGGCCTCGGTAGCCTACAAAAATTGCAAGTGGTGTTCGAGGCTGTGCGGAGAACACCTGAATCGGAACTGTTCGGATTCTGATATATCATTGAAGTTCCACTGCTTGTACCAGAGGACTGGGAACTGGAATTCGACGCTGAGGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

6.05

Weight (kDa)

9.23

Isoelectric Point (pI)

22.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 57
AcsI RAATTY 1 cut(s) 139
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 2 cut(s) 10, 103
AoxI GGCC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 139
BbvCI CCTCAGC 1 cut(s) 149
BmrI ACTGGG 1 cut(s) 138
BmuI ACTGGG 1 cut(s) 138
Bpu10I CCTNAGC 1 cut(s) 149
BsaJI CCNNGG 1 cut(s) 15
Bse1I ACTGG 2 cut(s) 133, 140
BseDI CCNNGG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 140
BseNI ACTGG 2 cut(s) 133, 140
BshFI GGCC 1 cut(s) 14
BsnI GGCC 1 cut(s) 14
BspACI CCGC 1 cut(s) 57
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 141
BsrI ACTGG 2 cut(s) 133, 140
BssECI CCNNGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 149
BstMWI GCNNNNNNNGC 2 cut(s) 11, 20
BstXI CCANNNNNNTGG 1 cut(s) 128
BsuRI GGCC 1 cut(s) 14
BtsI GCAGTG 1 cut(s) 109
BtsIMutI CAGTG 1 cut(s) 109
CseI GACGC 1 cut(s) 154
Csp6I GTAC 1 cut(s) 118
CviJI RGCY 3 cut(s) 14, 23, 52
CviKI_1 RGCY 3 cut(s) 14, 23, 52
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 149
Eco147I AGGCCT 1 cut(s) 14
EcoRI GAATTC 1 cut(s) 139
FaiI YATR 1 cut(s) 95
HaeIII GGCC 1 cut(s) 14
HgaI GACGC 1 cut(s) 154
HinfI GANTC 2 cut(s) 70, 86
Hpy188I TCNGA 3 cut(s) 75, 85, 91
Hpy99I CGWCG 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 4
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 20
HpyF3I CTNAG 1 cut(s) 149
LpnPI CCDG 4 cut(s) 80, 114, 121, 134
MluCI AATT 2 cut(s) 31, 139
MnlI CCTC 4 cut(s) 25, 42, 117, 144
MwoI GCNNNNNNNGC 2 cut(s) 11, 20
PceI AGGCCT 1 cut(s) 14
PfeI GAWTC 2 cut(s) 70, 86
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SetI ASST 1 cut(s) 69
SgeI CNNG 8 cut(s) 28, 49, 60, 79, 127, 133, 141, 148
Sse9I AATT 2 cut(s) 31, 139
SseBI AGGCCT 1 cut(s) 14
SsiI CCGC 1 cut(s) 57
StuI AGGCCT 1 cut(s) 14
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 2 cut(s) 47, 143
TasI AATT 2 cut(s) 31, 139
TfiI GAWTC 2 cut(s) 70, 86
TscAI CASTG 1 cut(s) 116
TspRI CASTG 1 cut(s) 116
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.