RchiOBHm_Chr2g0155381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
72247632 .. 72253416
5785 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52427

Sequence Viewer

Length: 189 bp
ATGGATGTCAAGAGTGAGTACATACCATCATGGAGGCTGATATGCACACTGCTGGATTTTACTACTCTTCAAACTGAAGTTAACCTACATAAAGAAGCTCGACAACTTTTGCTTATTTGTGATAAAGACCTTTTGCTAATTCAGTTTGTTATAACAAAGTATATAATGTTTTTACTTTTCTCCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.43

Weight (kDa)

5.59

Isoelectric Point (pI)

34.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 152
AcuI CTGAAG 1 cut(s) 96
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
BarI GAAGNNNNNNTAC 2 cut(s) 69, 101
BccI CCATC 1 cut(s) 34
BseGI GGATG 1 cut(s) 10
Bst6I CTCTTC 1 cut(s) 72
BstF5I GGATG 1 cut(s) 10
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 47
BtsIMutI CAGTG 1 cut(s) 47
Csp6I GTAC 1 cut(s) 19
CviAII CATG 1 cut(s) 30
CviJI RGCY 2 cut(s) 37, 98
CviKI_1 RGCY 2 cut(s) 37, 98
CviQI GTAC 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Eco57I CTGAAG 1 cut(s) 96
FaeI CATG 1 cut(s) 33
FaiI YATR 7 cut(s) 23, 31, 43, 90, 152, 162, 164
FatI CATG 1 cut(s) 29
FokI GGATG 1 cut(s) 17
FspEI CC 6 cut(s) 16, 19, 38, 39, 98, 143
Hin1II CATG 1 cut(s) 33
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HpaI GTTAAC 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 45
Hsp92II CATG 1 cut(s) 33
KspAI GTTAAC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 38
MboII GAAGA 1 cut(s) 59
MluCI AATT 1 cut(s) 138
MnlI CCTC 1 cut(s) 27
MseI TTAA 1 cut(s) 81
NlaIII CATG 1 cut(s) 33
PsiI TTATAA 1 cut(s) 152
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SaqAI TTAA 1 cut(s) 81
SetI ASST 3 cut(s) 87, 100, 132
SgeI CNNG 4 cut(s) 22, 42, 65, 111
Sse9I AATT 1 cut(s) 138
TaqI TCGA 1 cut(s) 100
TasI AATT 1 cut(s) 138
TatI WGTACW 1 cut(s) 18
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 54
TspRI CASTG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.