Rh5BG326100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
44575866 .. 44581662
5797 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG326100.1

Sequence Viewer

Length: 195 bp
ATGATCAAGTTTAAGAGCTTCTCTTACAATCCTATGTGCTACCTAAGTGCAATCCCGACTGACATGACCCCAACTACATTGATTCAGCTGCCTCATCAACTCTGGTCTGTTAGCAGAATATCAGAAGAGATCAGAAACGAGAACTTCTCCCTCTTGCCACCTATCCTATCTTTCAAGATCAGTCCAACGGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.39

Weight (kDa)

6.53

Isoelectric Point (pI)

36.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 18, 88
AluI AGCT 2 cut(s) 18, 88
ApeKI GCWGC 1 cut(s) 88
BbvI GCAGC 1 cut(s) 75
BclI TGATCA 1 cut(s) 3
BisI GCNGC 1 cut(s) 89
BlsI GCNGC 1 cut(s) 90
BplI GAGNNNNNCTC 2 cut(s) 131, 163
BseXI GCAGC 1 cut(s) 75
Bsp143I GATC 3 cut(s) 3, 129, 177
BssMI GATC 3 cut(s) 3, 129, 177
Bst6I CTCTTC 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 44
BstKTI GATC 3 cut(s) 6, 132, 180
BstMBI GATC 3 cut(s) 3, 129, 177
BstV1I GCAGC 1 cut(s) 75
CviAII CATG 1 cut(s) 64
CviJI RGCY 2 cut(s) 18, 88
CviKI_1 RGCY 2 cut(s) 18, 88
DdeI CTNAG 1 cut(s) 44
DpnI GATC 3 cut(s) 5, 131, 179
DpnII GATC 3 cut(s) 3, 129, 177
Eam1104I CTCTTC 1 cut(s) 120
EarI CTCTTC 1 cut(s) 120
FaeI CATG 1 cut(s) 67
FaiI YATR 2 cut(s) 35, 65
FatI CATG 1 cut(s) 63
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 89
Fsp4HI GCNGC 1 cut(s) 89
GluI GCNGC 1 cut(s) 89
Hin1II CATG 1 cut(s) 67
HinfI GANTC 1 cut(s) 82
Hpy188I TCNGA 2 cut(s) 124, 134
Hpy188III TCNNGA 2 cut(s) 55, 175
HpyCH4V TGCA 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 44
Hsp92II CATG 1 cut(s) 67
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 3 cut(s) 3, 129, 177
LpnPI CCDG 1 cut(s) 88
Lsp1109I GCAGC 1 cut(s) 75
MalI GATC 3 cut(s) 5, 131, 179
MboI GATC 3 cut(s) 3, 129, 177
MboII GAAGA 1 cut(s) 137
MnlI CCTC 2 cut(s) 102, 161
MseI TTAA 1 cut(s) 12
MspA1I CMGCKG 1 cut(s) 88
NdeII GATC 3 cut(s) 3, 129, 177
NlaIII CATG 1 cut(s) 67
PfeI GAWTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 90
PvuII CAGCTG 1 cut(s) 88
SaqAI TTAA 1 cut(s) 12
SatI GCNGC 1 cut(s) 89
Sau3AI GATC 3 cut(s) 3, 129, 177
SetI ASST 4 cut(s) 20, 45, 90, 163
SgeI CNNG 7 cut(s) 19, 67, 76, 115, 151, 166, 187
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TseI GCWGC 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.