Rh3BG074600

Formin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0003076
Physical Location & Seq
Forward (+)
5807461 .. 5811259
3799 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG074600.1

Sequence Viewer

Length: 258 bp
ATGGCCAAATGGCTGATTTTGTTTTTGTTTTTCATAGAAATGCTTATTGCTGAGAAAATGCCAGAGTTGCTGGATTTTGATAAGGATCTTATTCATTTGGAAGCTGCCTCTAAGATTCCATTGAAAGATTTAGCTGAAGAAATGCAAGCCGTGAGTAAAGGTCTTGAAAAGGTTGAGCAAGAACTTGCTGCTGCTGAAAACGACGGTGTAATCTCTTCTGGTTTTCGAAAGGTGATACCCACAATGGCAATCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FH2 PTEN_C2

Protein Analysis

85

Amino Acids

9.53

Weight (kDa)

4.64

Isoelectric Point (pI)

36.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FH2 PF02181 9 - 79 1.4e-12 Formin Homology 2 Domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 93
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 156
AgsI TTSAA 2 cut(s) 124, 167
AluBI AGCT 2 cut(s) 104, 134
AluI AGCT 2 cut(s) 104, 134
AlwI GGATC 1 cut(s) 93
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 3 cut(s) 104, 188, 191
AsuHPI GGTGA 1 cut(s) 244
AsuII TTCGAA 1 cut(s) 226
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 3 cut(s) 91, 175, 178
BceAI ACGGC 1 cut(s) 134
BisI GCNGC 3 cut(s) 105, 189, 192
BlsI GCNGC 3 cut(s) 106, 190, 193
Bpu14I TTCGAA 1 cut(s) 226
BsaBI GATNNNNATC 1 cut(s) 84
Bse8I GATNNNNATC 1 cut(s) 84
BseJI GATNNNNATC 1 cut(s) 84
BseMII CTCAG 1 cut(s) 42
BseXI GCAGC 3 cut(s) 91, 175, 178
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 226
Bsp143I GATC 1 cut(s) 85
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 43
BspPI GGATC 1 cut(s) 93
BspT104I TTCGAA 1 cut(s) 226
BssMI GATC 1 cut(s) 85
Bst4CI ACNGT 1 cut(s) 206
Bst6I CTCTTC 1 cut(s) 220
BstBI TTCGAA 1 cut(s) 226
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 51, 111
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstV1I GCAGC 3 cut(s) 91, 175, 178
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 147
CviJI RGCY 5 cut(s) 5, 13, 104, 134, 149
CviKI_1 RGCY 5 cut(s) 5, 13, 104, 134, 149
DdeI CTNAG 2 cut(s) 51, 111
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 220
EarI CTCTTC 1 cut(s) 220
Eco57I CTGAAG 1 cut(s) 156
FaiI YATR 1 cut(s) 35
Fnu4HI GCNGC 3 cut(s) 105, 189, 192
Fsp4HI GCNGC 3 cut(s) 105, 189, 192
GluI GCNGC 3 cut(s) 105, 189, 192
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 115
HphI GGTGA 1 cut(s) 244
Hpy188III TCNNGA 1 cut(s) 164
Hpy99I CGWCG 1 cut(s) 206
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
HpyF3I CTNAG 2 cut(s) 51, 111
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 3 cut(s) 56, 75, 204
Lsp1109I GCAGC 3 cut(s) 91, 175, 178
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 2 cut(s) 149, 207
MflI RGATCY 1 cut(s) 85
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 118
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 38
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 67
NdeII GATC 1 cut(s) 85
NspV TTCGAA 1 cut(s) 226
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 3 cut(s) 106, 190, 193
PsuI RGATCY 1 cut(s) 85
RseI CAYNNNNRTG 1 cut(s) 38
SatI GCNGC 3 cut(s) 105, 189, 192
Sau3AI GATC 1 cut(s) 85
SetI ASST 5 cut(s) 106, 136, 163, 174, 234
SfuI TTCGAA 1 cut(s) 226
SgeI CNNG 8 cut(s) 74, 83, 158, 163, 176, 191, 197, 231
SmiMI CAYNNNNRTG 1 cut(s) 38
TaaI ACNGT 1 cut(s) 206
TaqI TCGA 1 cut(s) 226
TfiI GAWTC 1 cut(s) 115
TseI GCWGC 3 cut(s) 104, 188, 191
TspDTI ATGAA 2 cut(s) 22, 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.