Rh4CG388200

Belongs to the CTL (choline transporter-like) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
63950442 .. 63952782
2341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG388200.1

Sequence Viewer

Length: 249 bp
ATGGTGGAAGCTCAGGTGTATGTGATTAGTGGGACTGTTGCTCAGTTGTACTTCACCAAGGAAGATTCGACTCCAAAGCGGGGGAGGCTTAAAAGGGTCAAAGATGGGTTCAGAGAGATGACACAGTGGTTTGAACAAGTAATCAGATATGCAGTTGACATGCCACAGGATATTCATGGAAATGATGTAAAGCTAAGTGAGTACAGTGGCAAGATGTCAAGAGTGAGTACATACCATCATGGAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.49

Weight (kDa)

9.0

Isoelectric Point (pI)

40.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AfaI GTAC 3 cut(s) 50, 203, 229
AfiI CCNNNNNNNGG 1 cut(s) 80
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 2 cut(s) 11, 193
AluI AGCT 2 cut(s) 11, 193
AsuHPI GGTGA 1 cut(s) 46
BccI CCATC 2 cut(s) 98, 243
Bpu10I CCTNAGC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 80
BseMII CTCAG 2 cut(s) 26, 56
BslFI GGGAC 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 46
BspACI CCGC 1 cut(s) 79
BspCNI CTCAG 2 cut(s) 25, 55
BssECI CCNNGG 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 57
Bst4CI ACNGT 3 cut(s) 37, 126, 206
BstDEI CTNAG 3 cut(s) 12, 42, 194
BstMWI GCNNNNNNNGC 1 cut(s) 85
BstNSI RCATGY 1 cut(s) 163
BtsIMutI CAGTG 2 cut(s) 131, 211
Csp6I GTAC 3 cut(s) 49, 202, 228
CviAII CATG 3 cut(s) 160, 176, 239
CviJI RGCY 4 cut(s) 11, 88, 193, 246
CviKI_1 RGCY 4 cut(s) 11, 88, 193, 246
CviQI GTAC 3 cut(s) 49, 202, 228
DdeI CTNAG 3 cut(s) 12, 42, 194
Eco130I CCWWGG 1 cut(s) 57
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 3 cut(s) 163, 179, 242
FaiI YATR 6 cut(s) 21, 150, 161, 177, 232, 240
FaqI GGGAC 1 cut(s) 46
FatI CATG 3 cut(s) 159, 175, 238
FauI CCCGC 1 cut(s) 72
Hin1II CATG 3 cut(s) 163, 179, 242
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HinfI GANTC 2 cut(s) 65, 70
HphI GGTGA 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 2 cut(s) 113, 146
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 1 cut(s) 157
HpyCH4III ACNGT 3 cut(s) 37, 126, 206
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
HpyF3I CTNAG 3 cut(s) 12, 42, 194
Hsp92II CATG 3 cut(s) 163, 179, 242
LpnPI CCDG 1 cut(s) 152
MboII GAAGA 1 cut(s) 74
MlyI GAGTC 1 cut(s) 64
MnlI CCTC 2 cut(s) 78, 236
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 85
NlaIII CATG 3 cut(s) 163, 179, 242
NspI RCATGY 1 cut(s) 163
PfeI GAWTC 1 cut(s) 65
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
RsaI GTAC 3 cut(s) 50, 203, 229
RsaNI GTAC 3 cut(s) 49, 202, 228
RseI CAYNNNNRTG 1 cut(s) 180
SaqAI TTAA 1 cut(s) 90
SchI GAGTC 1 cut(s) 64
SetI ASST 3 cut(s) 13, 18, 195
SgeI CNNG 9 cut(s) 26, 70, 92, 149, 172, 179, 188, 223, 231
SmiMI CAYNNNNRTG 1 cut(s) 180
SsiI CCGC 1 cut(s) 79
StyI CCWWGG 1 cut(s) 57
TaaI ACNGT 3 cut(s) 37, 126, 206
TaqI TCGA 1 cut(s) 68
TatI WGTACW 3 cut(s) 48, 201, 227
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 2 cut(s) 131, 211
TspDTI ATGAA 1 cut(s) 164
TspRI CASTG 2 cut(s) 131, 211
XceI RCATGY 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.