Rroxscaffold_1G00061570

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
83655586 .. 83656685
1100 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00061570.1

Sequence Viewer

Length: 180 bp
ATGATCAAAAGAATCCCTACTGCAGGGTCTGTTAATAGAATATCAGAAGACATTAGAGACAAGAACTTCTCCCTCTTGCCACCAATGAACCTCTATGAGGAGTTGAAAGCATTAAAGGATGTGGAGTCAAAACCAACCAATGTTGCGAATGAGGAACCAACCAAAAATGCGAAGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.64

Weight (kDa)

8.04

Isoelectric Point (pI)

30.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 23, 97
AgsI TTSAA 1 cut(s) 106
Alw26I GTCTC 1 cut(s) 51
AlwNI CAGNNNCTG 1 cut(s) 29
BbsI GAAGAC 1 cut(s) 54
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 156
BpiI GAAGAC 1 cut(s) 54
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 97
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 2 cut(s) 23, 97
BseRI GAGGAG 1 cut(s) 113
BslI CCNNNNNNNGG 2 cut(s) 23, 97
BsmAI GTCTC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 3
BspLI GGNNCC 1 cut(s) 156
BspMAI CTGCAG 1 cut(s) 25
BssMI GATC 1 cut(s) 3
BstENI CCTNNNNNAGG 2 cut(s) 21, 95
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 51
BstMBI GATC 1 cut(s) 3
BstSFI CTRYAG 1 cut(s) 21
BstV2I GAAGAC 1 cut(s) 54
BtsCI GGATG 1 cut(s) 124
CaiI CAGNNNCTG 1 cut(s) 29
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EcoNI CCTNNNNNAGG 2 cut(s) 21, 95
FaiI YATR 1 cut(s) 96
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 131
HinfI GANTC 2 cut(s) 12, 125
Hpy188I TCNGA 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 23
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 9
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 59
MlyI GAGTC 1 cut(s) 134
MnlI CCTC 4 cut(s) 83, 91, 101, 145
MseI TTAA 3 cut(s) 33, 113, 178
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 156
PfeI GAWTC 1 cut(s) 12
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 156
PstI CTGCAG 1 cut(s) 25
PstNI CAGNNNCTG 1 cut(s) 29
SaqAI TTAA 3 cut(s) 33, 113, 178
Sau3AI GATC 1 cut(s) 3
SchI GAGTC 1 cut(s) 134
SetI ASST 1 cut(s) 93
SfcI CTRYAG 1 cut(s) 21
SgeI CNNG 3 cut(s) 36, 73, 88
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 3 cut(s) 33, 113, 178
Tru9I TTAA 3 cut(s) 33, 113, 178
TspDTI ATGAA 1 cut(s) 101
XagI CCTNNNNNAGG 2 cut(s) 21, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.