RchiOBHm_Chr5g0082591

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
88546176 .. 88546649
474 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35679

Sequence Viewer

Length: 129 bp
ATGACGATCTTCTTCATCTTAACAGGAGTTTACGATTGTCAAATTGGGTTTATCATCAACAAGAAGAACGAAGGCGATTTTTGGAATTGCGTTGAGGAAAGTAGGAGAGCTGTAGGTGTATGTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.83

Weight (kDa)

4.71

Isoelectric Point (pI)

51.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
BfmI CTRYAG 1 cut(s) 111
Bsp143I GATC 1 cut(s) 6
BssMI GATC 1 cut(s) 6
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstSFI CTRYAG 1 cut(s) 111
CviJI RGCY 1 cut(s) 110
CviKI_1 RGCY 1 cut(s) 110
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
FaiI YATR 1 cut(s) 121
FspEI CC 8 cut(s) 9, 30, 31, 57, 67, 80, 88, 99
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 65
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 1 cut(s) 9
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 4, 76
MluCI AATT 2 cut(s) 42, 85
MnlI CCTC 1 cut(s) 88
MseI TTAA 1 cut(s) 20
NdeII GATC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 20
Sau3AI GATC 1 cut(s) 6
SetI ASST 2 cut(s) 112, 118
SfcI CTRYAG 1 cut(s) 111
SgeI CNNG 2 cut(s) 36, 73
Sse9I AATT 2 cut(s) 42, 85
TasI AATT 2 cut(s) 42, 85
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.