Rh5CG420400

Formin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0003076
Physical Location & Seq
Forward (+)
57842519 .. 57846128
3610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG420400.1

Sequence Viewer

Length: 249 bp
ATGCCAGAGTTGCTGGATTTTGATAAGGATCTTATTCATTTGGAAGCTGCCTCTAAGATTCCATTGAAAGCTTTAGCTGAAGAAATGCAAGCCGTGAGTAAAGGTCCTGAAAAGGTTAAGCAAGAACTTGCTGCTGCTGAAAACGACGGTGTAATCTCTTCTGGTTTTCGAAAGGTGAGAAATACGGAGGGGTTTCCTTTCGTAATTAAACATTATATACAAGAATTGAAAAAGCTATCCCCTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FH2 PTEN_C2

Protein Analysis

82

Amino Acids

9.18

Weight (kDa)

6.09

Isoelectric Point (pI)

45.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FH2 PF02181 1 - 59 6.4e-08 Formin Homology 2 Domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 99
AgsI TTSAA 2 cut(s) 67, 229
AluBI AGCT 4 cut(s) 47, 71, 77, 235
AluI AGCT 4 cut(s) 47, 71, 77, 235
AlwI GGATC 1 cut(s) 36
ApeKI GCWGC 3 cut(s) 47, 131, 134
AspS9I GGNCC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 187
AsuII TTCGAA 1 cut(s) 169
AvaII GGWCC 1 cut(s) 104
BbvI GCAGC 3 cut(s) 34, 118, 121
BceAI ACGGC 1 cut(s) 77
BisI GCNGC 3 cut(s) 48, 132, 135
BlsI GCNGC 3 cut(s) 49, 133, 136
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 104
Bpu14I TTCGAA 1 cut(s) 169
BsaBI GATNNNNATC 1 cut(s) 27
Bse8I GATNNNNATC 1 cut(s) 27
BseJI GATNNNNATC 1 cut(s) 27
BseXI GCAGC 3 cut(s) 34, 118, 121
Bsp119I TTCGAA 1 cut(s) 169
Bsp143I GATC 1 cut(s) 28
BspPI GGATC 1 cut(s) 36
BspT104I TTCGAA 1 cut(s) 169
BssMI GATC 1 cut(s) 28
Bst4CI ACNGT 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 163
BstBI TTCGAA 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 54
BstKTI GATC 1 cut(s) 31
BstMBI GATC 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstV1I GCAGC 3 cut(s) 34, 118, 121
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 90
Cfr13I GGNCC 1 cut(s) 104
CviJI RGCY 5 cut(s) 47, 71, 77, 92, 235
CviKI_1 RGCY 5 cut(s) 47, 71, 77, 92, 235
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 30
DpnII GATC 1 cut(s) 28
Eam1104I CTCTTC 1 cut(s) 163
EarI CTCTTC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 104
Eco57I CTGAAG 1 cut(s) 99
EcoO109I RGGNCCY 1 cut(s) 104
FaiI YATR 2 cut(s) 216, 218
Fnu4HI GCNGC 3 cut(s) 48, 132, 135
Fsp4HI GCNGC 3 cut(s) 48, 132, 135
GluI GCNGC 3 cut(s) 48, 132, 135
HindIII AAGCTT 1 cut(s) 69
HinfI GANTC 1 cut(s) 58
HphI GGTGA 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 248
Hpy188III TCNNGA 1 cut(s) 107
Hpy99I CGWCG 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 54
Kzo9I GATC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 18, 120, 147
Lsp1109I GCAGC 3 cut(s) 34, 118, 121
MalI GATC 1 cut(s) 30
MboI GATC 1 cut(s) 28
MboII GAAGA 2 cut(s) 92, 150
MflI RGATCY 1 cut(s) 28
MluCI AATT 2 cut(s) 204, 224
MnlI CCTC 2 cut(s) 61, 181
MseI TTAA 2 cut(s) 117, 207
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 28
NspV TTCGAA 1 cut(s) 169
PfeI GAWTC 1 cut(s) 58
PkrI GCNGC 3 cut(s) 49, 133, 136
PpuMI RGGWCCY 1 cut(s) 104
Psp5II RGGWCCY 1 cut(s) 104
PspPI GGNCC 1 cut(s) 104
PspPPI RGGWCCY 1 cut(s) 104
PsuI RGATCY 1 cut(s) 28
SaqAI TTAA 2 cut(s) 117, 207
SatI GCNGC 3 cut(s) 48, 132, 135
Sau3AI GATC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 104
SetI ASST 7 cut(s) 49, 73, 79, 106, 117, 177, 237
SfuI TTCGAA 1 cut(s) 169
SgeI CNNG 9 cut(s) 17, 26, 101, 106, 119, 134, 140, 174, 233
SinI GGWCC 1 cut(s) 104
Sse9I AATT 2 cut(s) 204, 224
TaaI ACNGT 1 cut(s) 149
TaqI TCGA 1 cut(s) 169
TasI AATT 2 cut(s) 204, 224
TfiI GAWTC 1 cut(s) 58
Tru1I TTAA 2 cut(s) 117, 207
Tru9I TTAA 2 cut(s) 117, 207
TseI GCWGC 3 cut(s) 47, 131, 134
TspDTI ATGAA 1 cut(s) 26
TspGWI ACGGA 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.