RchiOBHm_Chr4g0394041

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
9713131 .. 9713499
369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36657

Sequence Viewer

Length: 189 bp
ATGGCTTACCGTGGGAGTTGCCCTAAGGCTTGGAATTGTCAACGGTATATATCATGGATTGGAACAAAGCAGTGGAGATACTATGATTTTGGTCCAAAAGGAGTAGCTAGCTACGTGCACTTATTTGTCTTCCTGGAACAGCAAGGACGGCGGATGTCTATTACAAGAAGATCATGGCATTGTCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.51

Weight (kDa)

10.04

Isoelectric Point (pI)

65.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 151
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 2 cut(s) 107, 111
AluI AGCT 2 cut(s) 107, 111
Alw21I GWGCWC 1 cut(s) 120
Alw44I GTGCAC 1 cut(s) 116
ApaLI GTGCAC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 92
AsuNHI GCTAGC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 92
AxyI CCTNAGG 1 cut(s) 24
BaeGI GKGCMC 1 cut(s) 120
BbsI GAAGAC 1 cut(s) 121
Bbv12I GWGCWC 1 cut(s) 120
BceAI ACGGC 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 134
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 134
BmtI GCTAGC 1 cut(s) 111
BpiI GAAGAC 1 cut(s) 121
BsaAI YACGTR 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 10
Bse21I CCTNAGG 1 cut(s) 24
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 159
BseSI GKGCMC 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 120
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 170
BspACI CCGC 1 cut(s) 151
BspOI GCTAGC 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 10
BssMI GATC 1 cut(s) 170
Bst2UI CCWGG 1 cut(s) 134
Bst4CI ACNGT 2 cut(s) 11, 45
BstBAI YACGTR 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 24
BstDSI CCRYGG 1 cut(s) 10
BstF5I GGATG 1 cut(s) 159
BstKTI GATC 1 cut(s) 173
BstMBI GATC 1 cut(s) 170
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstSLI GKGCMC 1 cut(s) 120
BstV2I GAAGAC 1 cut(s) 121
Bsu36I CCTNAGG 1 cut(s) 24
BtgI CCRYGG 1 cut(s) 10
BtsCI GGATG 1 cut(s) 159
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 92
CviAII CATG 3 cut(s) 54, 174, 186
CviJI RGCY 4 cut(s) 5, 29, 107, 111
CviKI_1 RGCY 4 cut(s) 5, 29, 107, 111
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
EciI GGCGGA 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 92
Eco81I CCTNAGG 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 132
FaeI CATG 3 cut(s) 57, 177, 189
FaiI YATR 6 cut(s) 48, 50, 55, 84, 175, 187
FatI CATG 3 cut(s) 53, 173, 185
FokI GGATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 108
Hin1II CATG 3 cut(s) 57, 177, 189
HincII GTYRAC 1 cut(s) 41
HindII GTYRAC 1 cut(s) 41
Hpy166II GTNNAC 2 cut(s) 41, 118
Hpy8I GTNNAC 2 cut(s) 41, 118
HpyCH4III ACNGT 2 cut(s) 11, 45
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 1 cut(s) 118
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 24
HpySE526I ACGT 1 cut(s) 114
Hsp92II CATG 3 cut(s) 57, 177, 189
Kzo9I GATC 1 cut(s) 170
LpnPI CCDG 2 cut(s) 119, 146
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 114
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 2 cut(s) 121, 180
MhlI GDGCHC 1 cut(s) 120
MluCI AATT 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 1 cut(s) 170
NheI GCTAGC 1 cut(s) 107
NlaIII CATG 3 cut(s) 57, 177, 189
PfoI TCCNGGA 1 cut(s) 132
Ppu21I YACGTR 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 92
Sau3AI GATC 1 cut(s) 170
Sau96I GGNCC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 134
SduI GDGCHC 1 cut(s) 120
SetI ASST 3 cut(s) 109, 113, 117
SgeI CNNG 9 cut(s) 23, 42, 66, 120, 127, 145, 146, 155, 177
SinI GGWCC 1 cut(s) 92
Sse9I AATT 1 cut(s) 34
SsiI CCGC 1 cut(s) 151
SspMI CTAG 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 132
TaaI ACNGT 2 cut(s) 11, 45
TaiI ACGT 1 cut(s) 117
TasI AATT 1 cut(s) 34
TscAI CASTG 1 cut(s) 77
TspRI CASTG 1 cut(s) 77
VneI GTGCAC 1 cut(s) 116
VpaK11BI GGWCC 1 cut(s) 92
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.