Rroxscaffold_1G00063620

C3HC zinc finger-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
85431736 .. 85435166
3431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00063620.1

Sequence Viewer

Length: 279 bp
ATGGAGTTCGATTCTATTAAGCATCATGTACATTTCTTCCCCTGGATTGCATCAATAGGTAATGGAGCACCTAGAGGAAACAAGCACTCTCAGCTTTACAATGTCAAGAAGGAGACAACTACGAAGATGAAACAACACTATCAGATCAGACCAGCACAAATACATTGGTTCAATCTGACACAAAAGACCTTACCTAGCCACTTCTGCTTTGCAATCTTATGCTTTTTGTCAAGCTGTGTAACTTTTTTCGATAAGGATCATTCTCTATGTTTTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.83

Weight (kDa)

9.24

Isoelectric Point (pI)

39.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 264
AfaI GTAC 1 cut(s) 30
AgsI TTSAA 1 cut(s) 172
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 2 cut(s) 94, 234
AluI AGCT 2 cut(s) 94, 234
Alw21I GWGCWC 1 cut(s) 70
Alw26I GTCTC 1 cut(s) 107
AlwI GGATC 1 cut(s) 264
Bbv12I GWGCWC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 107
BfaI CTAG 2 cut(s) 72, 195
Bme1390I CCNGG 1 cut(s) 43
BmrFI CCNGG 1 cut(s) 43
BmsI GCATC 2 cut(s) 31, 59
BsaBI GATNNNNATC 1 cut(s) 255
BsaJI CCNNGG 1 cut(s) 41
Bse8I GATNNNNATC 1 cut(s) 255
BseBI CCWGG 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 41
BseJI GATNNNNATC 1 cut(s) 255
BseMII CTCAG 1 cut(s) 104
BsiHKAI GWGCWC 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 107
Bsp1286I GDGCHC 1 cut(s) 70
Bsp1407I TGTACA 1 cut(s) 28
Bsp143I GATC 2 cut(s) 144, 256
BspCNI CTCAG 1 cut(s) 103
BspPI GGATC 1 cut(s) 264
BsrGI TGTACA 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 2 cut(s) 144, 256
Bst2UI CCWGG 1 cut(s) 43
BstAUI TGTACA 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 90
BstKTI GATC 2 cut(s) 147, 259
BstMAI GTCTC 1 cut(s) 107
BstMBI GATC 2 cut(s) 144, 256
BstMWI GCNNNNNNNGC 2 cut(s) 91, 204
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 41
Csp6I GTAC 1 cut(s) 29
CviAII CATG 1 cut(s) 26
CviJI RGCY 3 cut(s) 94, 198, 234
CviKI_1 RGCY 3 cut(s) 94, 198, 234
CviQI GTAC 1 cut(s) 29
DdeI CTNAG 1 cut(s) 90
DpnI GATC 2 cut(s) 146, 258
DpnII GATC 2 cut(s) 144, 256
EcoRII CCWGG 1 cut(s) 41
FaeI CATG 1 cut(s) 29
FaiI YATR 3 cut(s) 27, 220, 268
FatI CATG 1 cut(s) 25
FspBI CTAG 2 cut(s) 72, 195
Hin1II CATG 1 cut(s) 29
HinfI GANTC 1 cut(s) 11
Hpy188I TCNGA 3 cut(s) 144, 149, 177
Hpy188III TCNNGA 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 50, 212
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 204
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 1 cut(s) 29
Kzo9I GATC 2 cut(s) 144, 256
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 3 cut(s) 28, 55, 165
LweI GCATC 2 cut(s) 31, 59
MaeI CTAG 2 cut(s) 72, 195
MaeIII GTNAC 1 cut(s) 238
MalI GATC 2 cut(s) 146, 258
MboI GATC 2 cut(s) 144, 256
MboII GAAGA 2 cut(s) 28, 136
MhlI GDGCHC 1 cut(s) 70
MnlI CCTC 1 cut(s) 68
MseI TTAA 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 43
MvaI CCWGG 1 cut(s) 43
MwoI GCNNNNNNNGC 2 cut(s) 91, 204
NdeII GATC 2 cut(s) 144, 256
NlaIII CATG 1 cut(s) 29
PfeI GAWTC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 2 cut(s) 144, 256
ScrFI CCNGG 1 cut(s) 43
SduI GDGCHC 1 cut(s) 70
SetI ASST 6 cut(s) 61, 73, 96, 191, 196, 236
SfaNI GCATC 2 cut(s) 31, 59
SgeI CNNG 9 cut(s) 38, 54, 55, 84, 94, 118, 164, 207, 243
SspMI CTAG 2 cut(s) 72, 195
StyD4I CCNGG 1 cut(s) 41
TaqI TCGA 2 cut(s) 9, 249
TatI WGTACW 1 cut(s) 28
TfiI GAWTC 1 cut(s) 11
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 143
XspI CTAG 2 cut(s) 72, 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.