Rw6G005030

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0004881
Physical Location & Seq
Forward (+)
8251741 .. 8253236
1496 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G005030.1

Sequence Viewer

Length: 312 bp
ATGCATGTAGACATAGGTTGCTTCTACGTTCAAGATTGGAAGAATTTTTGGGTGGAGCTATCGGTGATTTTTGCTCAAGTTGTATCTAGCTGGAGCTATCAGTGGTTCAGTCGTTTACTTGGAGCACCATACCTGGATGTACTTACCGCCAGAGGGAAAGATCTAAGGCATGCATCACCAGTTCAATGGAGTTCGGTTCTATTAAGCATCATAGACATTTCTGCTCCTAGATTGCATCAACAGGTAATGGAGCACCTGGATGGAAACAACCACAGTCAGCTTTACAATGTCAAGAAGGGTAAGATTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.95

Weight (kDa)

7.94

Isoelectric Point (pI)

30.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 9
AciI CCGC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 43
AfaI GTAC 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 153
AgsI TTSAA 2 cut(s) 32, 185
AjnI CCWGG 2 cut(s) 132, 255
AluBI AGCT 4 cut(s) 58, 90, 96, 280
AluI AGCT 4 cut(s) 58, 90, 96, 280
Alw21I GWGCWC 2 cut(s) 127, 255
ApoI RAATTY 1 cut(s) 43
AsuHPI GGTGA 2 cut(s) 76, 168
Bbv12I GWGCWC 2 cut(s) 127, 255
BccI CCATC 1 cut(s) 254
BciT130I CCWGG 2 cut(s) 134, 257
BfaI CTAG 2 cut(s) 87, 228
BglII AGATCT 1 cut(s) 160
Bme1390I CCNGG 2 cut(s) 134, 257
BmrFI CCNGG 2 cut(s) 134, 257
BmsI GCATC 3 cut(s) 182, 216, 244
BpmI CTGGAG 1 cut(s) 112
BpuEI CTTGAG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 179
BseBI CCWGG 2 cut(s) 134, 257
BseGI GGATG 2 cut(s) 142, 265
BseLI CCNNNNNNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 179
BsiHKAI GWGCWC 2 cut(s) 127, 255
BslI CCNNNNNNNGG 1 cut(s) 153
Bsp1286I GDGCHC 2 cut(s) 127, 255
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 147
BsrI ACTGG 1 cut(s) 179
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 2 cut(s) 134, 257
Bst4CI ACNGT 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 164
BstF5I GGATG 2 cut(s) 142, 265
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstNI CCWGG 2 cut(s) 134, 257
BstNSI RCATGY 2 cut(s) 8, 173
BstSCI CCNGG 2 cut(s) 132, 255
BstX2I RGATCY 1 cut(s) 160
BstXI CCANNNNNNTGG 1 cut(s) 186
BstYI RGATCY 1 cut(s) 160
BtsCI GGATG 2 cut(s) 142, 265
BtsIMutI CAGTG 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 171
Csp6I GTAC 1 cut(s) 140
CviAII CATG 2 cut(s) 5, 170
CviJI RGCY 4 cut(s) 58, 90, 96, 280
CviKI_1 RGCY 4 cut(s) 58, 90, 96, 280
CviQI GTAC 1 cut(s) 140
DdeI CTNAG 1 cut(s) 164
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
EcoRII CCWGG 2 cut(s) 132, 255
EcoT22I ATGCAT 2 cut(s) 6, 175
FaeI CATG 2 cut(s) 8, 173
FaiI YATR 6 cut(s) 6, 14, 130, 171, 212, 308
FatI CATG 2 cut(s) 4, 169
FblI GTMKAC 1 cut(s) 9
FokI GGATG 2 cut(s) 149, 272
FspBI CTAG 2 cut(s) 87, 228
GsuI CTGGAG 1 cut(s) 112
Hin1II CATG 2 cut(s) 8, 173
HphI GGTGA 2 cut(s) 76, 168
Hpy166II GTNNAC 2 cut(s) 10, 116
Hpy188III TCNNGA 2 cut(s) 32, 292
Hpy8I GTNNAC 2 cut(s) 10, 116
HpyAV CCTTC 1 cut(s) 289
HpyCH4III ACNGT 1 cut(s) 275
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 3 cut(s) 4, 173, 235
HpyF3I CTNAG 1 cut(s) 164
HpySE526I ACGT 1 cut(s) 27
Hsp92II CATG 2 cut(s) 8, 173
Kzo9I GATC 1 cut(s) 160
LmnI GCTCC 5 cut(s) 55, 93, 122, 229, 250
LpnPI CCDG 8 cut(s) 76, 119, 146, 163, 192, 227, 242, 269
LweI GCATC 3 cut(s) 182, 216, 244
MaeI CTAG 2 cut(s) 87, 228
MaeII ACGT 1 cut(s) 27
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 1 cut(s) 52
MflI RGATCY 1 cut(s) 160
MhlI GDGCHC 2 cut(s) 127, 255
MluCI AATT 1 cut(s) 43
MnlI CCTC 1 cut(s) 146
Mph1103I ATGCAT 2 cut(s) 6, 175
MseI TTAA 1 cut(s) 203
MslI CAYNNNNRTG 1 cut(s) 258
MspR9I CCNGG 2 cut(s) 134, 257
MvaI CCWGG 2 cut(s) 134, 257
NdeII GATC 1 cut(s) 160
NlaIII CATG 2 cut(s) 8, 173
NsiI ATGCAT 2 cut(s) 6, 175
NspI RCATGY 2 cut(s) 8, 173
PaeI GCATGC 1 cut(s) 173
Psp6I CCWGG 2 cut(s) 132, 255
PspGI CCWGG 2 cut(s) 132, 255
PsuI RGATCY 1 cut(s) 160
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 258
SaqAI TTAA 1 cut(s) 203
Sau3AI GATC 1 cut(s) 160
ScrFI CCNGG 2 cut(s) 134, 257
SduI GDGCHC 2 cut(s) 127, 255
SetI ASST 9 cut(s) 19, 30, 60, 92, 98, 135, 246, 258, 282
SfaNI GCATC 3 cut(s) 182, 216, 244
SmiMI CAYNNNNRTG 1 cut(s) 258
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
SphI GCATGC 1 cut(s) 173
Sse9I AATT 1 cut(s) 43
SsiI CCGC 1 cut(s) 147
SspMI CTAG 2 cut(s) 87, 228
StyD4I CCNGG 2 cut(s) 132, 255
TaaI ACNGT 1 cut(s) 275
TaiI ACGT 1 cut(s) 30
TasI AATT 1 cut(s) 43
TatI WGTACW 1 cut(s) 139
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TscAI CASTG 1 cut(s) 107
TspRI CASTG 1 cut(s) 107
XapI RAATTY 1 cut(s) 43
XceI RCATGY 2 cut(s) 8, 173
XmiI GTMKAC 1 cut(s) 9
XspI CTAG 2 cut(s) 87, 228
Zsp2I ATGCAT 2 cut(s) 6, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.