Rroxscaffold_4G00316650

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
41639553 .. 41643884
4332 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316650.1

Sequence Viewer

Length: 192 bp
ATGTTCAATCTATCCATAAAAGAGTCTCAAGCAACAGCATTTGACACAGTTTCAGATAACTACAACTTCAATACACTTCATGCAAGTGGCTTTCTATGGACTATCAGTGACCTCAGCAACAATCTGGATCAACATTATCTTCTCATTAGGTTTGATTTCAAGTTAATGATTCTGGTGGAGAAATTCGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.38

Weight (kDa)

4.91

Isoelectric Point (pI)

18.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 135
AcsI RAATTY 1 cut(s) 182
AgsI TTSAA 3 cut(s) 7, 70, 160
Alw26I GTCTC 1 cut(s) 30
AlwI GGATC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 182
BbvCI CCTCAGC 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 30
Bpu10I CCTNAGC 1 cut(s) 113
BpuEI CTTGAG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 126
BspPI GGATC 1 cut(s) 135
BssMI GATC 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 113
BstKTI GATC 1 cut(s) 130
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 112
CviAII CATG 1 cut(s) 80
CviJI RGCY 1 cut(s) 90
CviKI_1 RGCY 1 cut(s) 90
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
FaeI CATG 1 cut(s) 83
FaiI YATR 3 cut(s) 17, 81, 97
FatI CATG 1 cut(s) 79
FspEI CC 8 cut(s) 28, 72, 82, 110, 125, 133, 158, 161
Hin1II CATG 1 cut(s) 83
HinfI GANTC 2 cut(s) 23, 169
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 110, 158
MaeIII GTNAC 1 cut(s) 107
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 1 cut(s) 131
MluCI AATT 1 cut(s) 182
MlyI GAGTC 1 cut(s) 32
MnlI CCTC 1 cut(s) 122
MseI TTAA 1 cut(s) 164
MslI CAYNNNNRTG 1 cut(s) 84
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 1 cut(s) 169
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 1 cut(s) 32
SetI ASST 2 cut(s) 114, 152
SgeI CNNG 6 cut(s) 41, 92, 96, 137, 172, 185
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 27
SmoI CTYRAG 1 cut(s) 27
Sse9I AATT 1 cut(s) 182
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 182
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 68
TspRI CASTG 1 cut(s) 112
XapI RAATTY 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.