RchiOBHm_Chr5g0040341

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
35014612 .. 35019455
4844 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31885

Sequence Viewer

Length: 192 bp
ATGTTCAATGTATCCATAAAAGAGTCTCAAGCAACAGCATTTGACAGAGTTTCAGATAACTACAACTTCAATACACTTCATGCAAGTGGCTTTCTATGGACTATCAGTGACCTGAACAACCATCTGGATCAACATTATCTTCTCAGTAGGTTTGATTTCAAGTTAATGATTTTGGTGGAGAAATTGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.41

Weight (kDa)

5.77

Isoelectric Point (pI)

21.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 135
AgsI TTSAA 3 cut(s) 7, 70, 160
Alw26I GTCTC 1 cut(s) 30
AlwI GGATC 1 cut(s) 135
BccI CCATC 1 cut(s) 129
BciVI GTATCC 1 cut(s) 22
BcoDI GTCTC 1 cut(s) 30
BfuI GTATCC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 157
BsmAI GTCTC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 156
BspPI GGATC 1 cut(s) 135
BssMI GATC 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 143
BstKTI GATC 1 cut(s) 130
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 1 cut(s) 127
BsuI GTATCC 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 112
CviAII CATG 1 cut(s) 80
CviJI RGCY 1 cut(s) 90
CviKI_1 RGCY 1 cut(s) 90
DdeI CTNAG 1 cut(s) 143
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
FaeI CATG 1 cut(s) 83
FaiI YATR 3 cut(s) 17, 81, 97
FatI CATG 1 cut(s) 79
Hin1II CATG 1 cut(s) 83
HinfI GANTC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 143
Hsp92II CATG 1 cut(s) 83
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 110, 125
MaeIII GTNAC 1 cut(s) 107
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 1 cut(s) 131
MluCI AATT 1 cut(s) 182
MlyI GAGTC 1 cut(s) 32
MseI TTAA 1 cut(s) 164
MslI CAYNNNNRTG 1 cut(s) 84
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 107
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 1 cut(s) 32
SetI ASST 2 cut(s) 114, 152
SgeI CNNG 6 cut(s) 41, 92, 96, 124, 137, 172
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 27
SmoI CTYRAG 1 cut(s) 27
Sse9I AATT 1 cut(s) 182
TasI AATT 1 cut(s) 182
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 68
TspRI CASTG 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.