RchiOBHm_Chr5g0026981

Protein of unknown function (DUF423)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
20939443 .. 20941611
2169 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30654

Sequence Viewer

Length: 246 bp
ATGAATCCTATACTATGGCACAAATTAGCTGCAGTCTCTGGAATGGCAGCTTTTGGGTTGGGCATATATGGTGCTGATGGCTTTAAACCCAAAAACCCAGCTTACAAGGAGAAAACATTCCAAACTTTGCCAACATTTGGGAATCTCAGACAATTGAACTTGGATATCCCTTCATACCAAAGTAAAAGTGAGGAAGTTCTAGCCAATCTCAGCAACGGACAACCAAGGACATCTCTGAGGAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.9

Weight (kDa)

9.7

Isoelectric Point (pI)

46.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 137
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 4 cut(s) 29, 50, 101, 243
AluI AGCT 4 cut(s) 29, 50, 101, 243
Alw26I GTCTC 1 cut(s) 40
AlwNI CAGNNNCTG 1 cut(s) 38
ApeKI GCWGC 2 cut(s) 29, 47
Asp700I GAANNNNTTC 1 cut(s) 116
BbvI GCAGC 2 cut(s) 16, 59
BccI CCATC 1 cut(s) 71
BcoDI GTCTC 1 cut(s) 40
BfaI CTAG 1 cut(s) 200
BfmI CTRYAG 1 cut(s) 30
BisI GCNGC 2 cut(s) 30, 48
BlsI GCNGC 2 cut(s) 31, 49
BsaJI CCNNGG 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 3 cut(s) 160, 223, 227
BseXI GCAGC 2 cut(s) 16, 59
BseYI CCCAGC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 40
BspCNI CTCAG 3 cut(s) 159, 222, 228
BspMAI CTGCAG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 224
BssT1I CCWWGG 1 cut(s) 224
BstDEI CTNAG 3 cut(s) 146, 209, 236
BstMAI GTCTC 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 30
BstV1I GCAGC 2 cut(s) 16, 59
CaiI CAGNNNCTG 1 cut(s) 38
CviJI RGCY 6 cut(s) 29, 50, 81, 101, 203, 243
CviKI_1 RGCY 6 cut(s) 29, 50, 81, 101, 203, 243
DdeI CTNAG 3 cut(s) 146, 209, 236
DraI TTTAAA 1 cut(s) 85
Eco130I CCWWGG 1 cut(s) 224
Eco32I GATATC 1 cut(s) 166
EcoRV GATATC 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 224
ErhI CCWWGG 1 cut(s) 224
FaiI YATR 6 cut(s) 11, 16, 65, 67, 69, 175
Fnu4HI GCNGC 2 cut(s) 30, 48
Fsp4HI GCNGC 2 cut(s) 30, 48
FspBI CTAG 1 cut(s) 200
GluI GCNGC 2 cut(s) 30, 48
GsaI CCCAGC 1 cut(s) 101
HinfI GANTC 2 cut(s) 4, 142
Hpy188I TCNGA 2 cut(s) 149, 237
Hpy188III TCNNGA 1 cut(s) 39
HpyAV CCTTC 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 3 cut(s) 146, 209, 236
LmnI GCTCC 1 cut(s) 240
LpnPI CCDG 2 cut(s) 24, 111
Lsp1109I GCAGC 2 cut(s) 16, 59
MaeI CTAG 1 cut(s) 200
MfeI CAATTG 1 cut(s) 152
MluCI AATT 2 cut(s) 23, 152
MnlI CCTC 2 cut(s) 184, 231
MroXI GAANNNNTTC 1 cut(s) 116
MseI TTAA 1 cut(s) 84
MunI CAATTG 1 cut(s) 152
PdmI GAANNNNTTC 1 cut(s) 116
PfeI GAWTC 2 cut(s) 4, 142
PflMI CCANNNNNTGG 1 cut(s) 137
PkrI GCNGC 2 cut(s) 31, 49
PspFI CCCAGC 1 cut(s) 97
PstI CTGCAG 1 cut(s) 34
PstNI CAGNNNCTG 1 cut(s) 38
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 2 cut(s) 30, 48
SetI ASST 4 cut(s) 31, 52, 103, 245
SfcI CTRYAG 1 cut(s) 30
SgeI CNNG 6 cut(s) 51, 110, 118, 172, 212, 237
Sse9I AATT 2 cut(s) 23, 152
SspMI CTAG 1 cut(s) 200
StyI CCWWGG 1 cut(s) 224
TasI AATT 2 cut(s) 23, 152
TfiI GAWTC 2 cut(s) 4, 142
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseI GCWGC 2 cut(s) 29, 47
TspDTI ATGAA 2 cut(s) 17, 162
TspGWI ACGGA 1 cut(s) 231
Van91I CCANNNNNTGG 1 cut(s) 137
XmnI GAANNNNTTC 1 cut(s) 116
XspI CTAG 1 cut(s) 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.