Rh3AG336100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
49007791 .. 49015510
7720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG336100.1

Sequence Viewer

Length: 267 bp
ATGCAAGGAATTCCTGTTTGTGATAGCAGTGAAGAACATAAAGTTCATTTTAGCAGATCAAGCCGTGCTGTTGTTGCTTTGTTGATTCGGTACTGTTGTCTCTACCGTGAAGGTGATCAGAAAACATTCCTAACTTTGCCAACGTTTGGGAATCTCAAGCAATTGAACTTGGACCTCCTTTCATACCAGAAGAAGTTAGGAAGAAGTTTGTTACAGGAGCTTCTGTTGTTAAGTGTGTCAAACTTGATCGGCTTGCACTTCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.02

Weight (kDa)

8.93

Isoelectric Point (pI)

47.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AclI AACGTT 1 cut(s) 143
AcsI RAATTY 1 cut(s) 9
AfaI GTAC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 1 cut(s) 166
AluBI AGCT 1 cut(s) 220
AluI AGCT 1 cut(s) 220
Alw26I GTCTC 1 cut(s) 104
ApoI RAATTY 1 cut(s) 9
Asp700I GAANNNNTTC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 172
AsuHPI GGTGA 1 cut(s) 125
AvaII GGWCC 1 cut(s) 172
BaeI ACNNNNGTAYC 2 cut(s) 82, 115
BceAI ACGGC 1 cut(s) 48
BclI TGATCA 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 104
BfaI CTAG 1 cut(s) 265
Bme18I GGWCC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 172
BpuEI CTTGAG 1 cut(s) 140
BsaXI ACNNNNNCTCC 2 cut(s) 209, 239
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 146
BslI CCNNNNNNNGG 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 104
Bsp143I GATC 3 cut(s) 56, 115, 246
BssMI GATC 3 cut(s) 56, 115, 246
Bst4CI ACNGT 2 cut(s) 95, 107
BstC8I GCNNGC 1 cut(s) 254
BstKTI GATC 3 cut(s) 59, 118, 249
BstMAI GTCTC 1 cut(s) 104
BstMBI GATC 3 cut(s) 56, 115, 246
BstMWI GCNNNNNNNGC 2 cut(s) 60, 74
BtsI GCAGTG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 254
Cfr13I GGNCC 1 cut(s) 172
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 3 cut(s) 63, 220, 252
CviKI_1 RGCY 3 cut(s) 63, 220, 252
CviQI GTAC 1 cut(s) 91
DpnI GATC 3 cut(s) 58, 117, 248
DpnII GATC 3 cut(s) 56, 115, 246
Eco47I GGWCC 1 cut(s) 172
EcoRI GAATTC 1 cut(s) 9
FaiI YATR 2 cut(s) 39, 184
FbaI TGATCA 1 cut(s) 115
FspBI CTAG 1 cut(s) 265
HinfI GANTC 2 cut(s) 85, 151
HphI GGTGA 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 2 cut(s) 95, 107
HpyCH4IV ACGT 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 4, 256
HpyF10VI GCNNNNNNNGC 2 cut(s) 60, 74
HpySE526I ACGT 1 cut(s) 143
Ksp22I TGATCA 1 cut(s) 115
Kzo9I GATC 3 cut(s) 56, 115, 246
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 3 cut(s) 27, 200, 200
MaeI CTAG 1 cut(s) 265
MaeII ACGT 1 cut(s) 143
MaeIII GTNAC 1 cut(s) 210
MalI GATC 3 cut(s) 58, 117, 248
MboI GATC 3 cut(s) 56, 115, 246
MboII GAAGA 3 cut(s) 44, 202, 213
MfeI CAATTG 1 cut(s) 161
MluCI AATT 2 cut(s) 9, 161
MnlI CCTC 1 cut(s) 185
MroXI GAANNNNTTC 1 cut(s) 125
MseI TTAA 1 cut(s) 230
MunI CAATTG 1 cut(s) 161
MwoI GCNNNNNNNGC 2 cut(s) 60, 74
NdeII GATC 3 cut(s) 56, 115, 246
PdmI GAANNNNTTC 1 cut(s) 125
PfeI GAWTC 2 cut(s) 85, 151
PflMI CCANNNNNTGG 1 cut(s) 146
Psp1406I AACGTT 1 cut(s) 143
PspPI GGNCC 1 cut(s) 172
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 230
Sau3AI GATC 3 cut(s) 56, 115, 246
Sau96I GGNCC 1 cut(s) 172
SetI ASST 4 cut(s) 115, 146, 177, 222
SinI GGWCC 1 cut(s) 172
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 2 cut(s) 9, 161
SspMI CTAG 1 cut(s) 265
TaaI ACNGT 2 cut(s) 95, 107
TaiI ACGT 1 cut(s) 146
TasI AATT 2 cut(s) 9, 161
TfiI GAWTC 2 cut(s) 85, 151
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 3 cut(s) 35, 171, 250
TspRI CASTG 1 cut(s) 34
Van91I CCANNNNNTGG 1 cut(s) 146
VpaK11BI GGWCC 1 cut(s) 172
XapI RAATTY 1 cut(s) 9
XmnI GAANNNNTTC 1 cut(s) 125
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.