Rh3DG213000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0002952
Physical Location & Seq
Forward (+)
19707865 .. 19709172
1308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG213000.1

Sequence Viewer

Length: 165 bp
ATGCAGAACTGGAGCCAAGGGGAAGAGAAGCATTTGGGTCTCGGTTTTGATAGGTGCAACGATATTGATCCAATTAGAGTTAATCTTTACGTGAATGAAATACCCCAAAGCTTACCAACATTTAGCAATCTCAATCAATTGAACATGGACCTCTTTTCATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.32

Weight (kDa)

4.38

Isoelectric Point (pI)

34.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 62
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 44
AlwI GGATC 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BcoDI GTCTC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmiI GGNNCC 1 cut(s) 14
BpmI CTGGAG 1 cut(s) 31
BsaAI YACGTR 1 cut(s) 91
BsaBI GATNNNNATC 1 cut(s) 66
BsaI GGTCTC 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 14
Bse8I GATNNNNATC 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 16
BseJI GATNNNNATC 1 cut(s) 66
BseNI ACTGG 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 44
Bso31I GGTCTC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 14
BspPI GGATC 1 cut(s) 62
BspTNI GGTCTC 1 cut(s) 44
BsrI ACTGG 1 cut(s) 14
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 1 cut(s) 67
BssT1I CCWWGG 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 18
BstBAI YACGTR 1 cut(s) 91
BstKTI GATC 1 cut(s) 70
BstMAI GTCTC 1 cut(s) 44
BstMBI GATC 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 148
CviAII CATG 1 cut(s) 145
CviJI RGCY 2 cut(s) 15, 111
CviKI_1 RGCY 2 cut(s) 15, 111
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 16
Eco31I GGTCTC 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 1 cut(s) 148
FaiI YATR 2 cut(s) 146, 160
FatI CATG 1 cut(s) 144
GsuI CTGGAG 1 cut(s) 31
Hin1II CATG 1 cut(s) 148
HindIII AAGCTT 1 cut(s) 109
HpyCH4IV ACGT 1 cut(s) 90
HpyCH4V TGCA 2 cut(s) 4, 57
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 1 cut(s) 148
Kzo9I GATC 1 cut(s) 67
LmnI GCTCC 1 cut(s) 12
MaeII ACGT 1 cut(s) 90
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 35
MfeI CAATTG 1 cut(s) 137
MluCI AATT 2 cut(s) 72, 137
MnlI CCTC 1 cut(s) 161
MseI TTAA 1 cut(s) 81
MunI CAATTG 1 cut(s) 137
NdeII GATC 1 cut(s) 67
NlaIII CATG 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 14
Ppu21I YACGTR 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 67
Sau96I GGNCC 1 cut(s) 148
SetI ASST 4 cut(s) 56, 93, 113, 153
SgeI CNNG 5 cut(s) 22, 29, 53, 103, 157
SinI GGWCC 1 cut(s) 148
Sse9I AATT 2 cut(s) 72, 137
StyI CCWWGG 1 cut(s) 16
TaiI ACGT 1 cut(s) 93
TasI AATT 2 cut(s) 72, 137
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 111, 147
VpaK11BI GGWCC 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.