Rh4BG061500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
11038681 .. 11041501
2821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG061500.1

Sequence Viewer

Length: 201 bp
ATGGAGATTATTAAAACATTCCTAACTCTGCCAACGTTTGGGAATCTCAAGCAATTGAACTTGGACCTCCTTTCATACCAAAGTAAAAGTAAGAAAGATTACATTTCAGGTGTCAAGCTTAATAATGCTTCAGAGAAGTTAGGAAGAAGTTTGTTACAGGAGCTTCTGTTGTTAAGATTTCTGTCCTCCCAATACAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.58

Weight (kDa)

9.63

Isoelectric Point (pI)

47.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 38
AclI AACGTT 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 2 cut(s) 118, 163
AluI AGCT 2 cut(s) 118, 163
AspS9I GGNCC 1 cut(s) 64
AvaII GGWCC 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BpuEI CTTGAG 1 cut(s) 32
BsaXI ACNNNNNCTCC 2 cut(s) 152, 182
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 64
CviJI RGCY 2 cut(s) 118, 163
CviKI_1 RGCY 2 cut(s) 118, 163
Eco47I GGWCC 1 cut(s) 64
Eco57I CTGAAG 1 cut(s) 114
FaiI YATR 1 cut(s) 76
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 35
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 2 cut(s) 93, 143
MaeII ACGT 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 153
MboII GAAGA 1 cut(s) 156
MfeI CAATTG 1 cut(s) 53
MluCI AATT 1 cut(s) 53
MnlI CCTC 2 cut(s) 77, 196
MseI TTAA 3 cut(s) 12, 120, 173
MunI CAATTG 1 cut(s) 53
PfeI GAWTC 1 cut(s) 43
PflMI CCANNNNNTGG 1 cut(s) 38
Psp1406I AACGTT 1 cut(s) 35
PspPI GGNCC 1 cut(s) 64
SaqAI TTAA 3 cut(s) 12, 120, 173
Sau96I GGNCC 1 cut(s) 64
SetI ASST 5 cut(s) 38, 69, 112, 120, 165
SgeI CNNG 5 cut(s) 61, 73, 120, 127, 170
SinI GGWCC 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 53
TaiI ACGT 1 cut(s) 38
TasI AATT 1 cut(s) 53
TfiI GAWTC 1 cut(s) 43
Tru1I TTAA 3 cut(s) 12, 120, 173
Tru9I TTAA 3 cut(s) 12, 120, 173
TspDTI ATGAA 1 cut(s) 63
Van91I CCANNNNNTGG 1 cut(s) 38
VpaK11BI GGWCC 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.