Rh7DG288500

Protein of unknown function (DUF423)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
32240135 .. 32241490
1356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG288500.1

Sequence Viewer

Length: 333 bp
ATGTGTATTGGATTTCAATTTGCAGGTATTTATTTGGTGGTTTGTATCAAATCTTCGAAAGGAAACCAAGCAAGGGAAGAAACAGCAATGAATCCTATACTATGGCACAAAGTAGCTGCAGTCTCTGGAATGGCAGCTTTTGGGTTGGGCATATATGGTGCTGATGGCTTTAAACCCAAAAACCCAGCTTACAAGGAGAAAACATTCCAAACTTTGCCAACATTTGGGAATCTCAGACAATTGAACTTGGATATCCTTTCATACCAAAGTAAAAGTGAGGAAGTTCTAGCCAATCTCAGCAACGGACAACCAAGGACATCTCTGAGGAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.05

Weight (kDa)

9.43

Isoelectric Point (pI)

37.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 14
AccB7I CCANNNNNTGG 1 cut(s) 224
AfiI CCNNNNNNNGG 2 cut(s) 73, 224
AgsI TTSAA 2 cut(s) 17, 244
AluBI AGCT 4 cut(s) 116, 137, 188, 330
AluI AGCT 4 cut(s) 116, 137, 188, 330
Alw26I GTCTC 1 cut(s) 127
AlwNI CAGNNNCTG 1 cut(s) 125
ApeKI GCWGC 2 cut(s) 116, 134
Asp700I GAANNNNTTC 1 cut(s) 203
AsuII TTCGAA 1 cut(s) 56
BarI GAAGNNNNNNTAC 2 cut(s) 37, 69
BbvI GCAGC 2 cut(s) 103, 146
BccI CCATC 1 cut(s) 158
BcoDI GTCTC 1 cut(s) 127
BfaI CTAG 1 cut(s) 287
BfmI CTRYAG 1 cut(s) 117
BfuAI ACCTGC 1 cut(s) 14
BisI GCNGC 2 cut(s) 117, 135
BlsI GCNGC 2 cut(s) 118, 136
Bpu14I TTCGAA 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 311
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 224
Bse3DI GCAATG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 311
BseLI CCNNNNNNNGG 2 cut(s) 73, 224
BseMI GCAATG 1 cut(s) 93
BseMII CTCAG 3 cut(s) 247, 310, 314
BseXI GCAGC 2 cut(s) 103, 146
BseYI CCCAGC 1 cut(s) 184
BslI CCNNNNNNNGG 2 cut(s) 73, 224
BsmAI GTCTC 1 cut(s) 127
Bsp119I TTCGAA 1 cut(s) 56
BspCNI CTCAG 3 cut(s) 246, 309, 315
BspMAI CTGCAG 1 cut(s) 121
BspMI ACCTGC 1 cut(s) 14
BspT104I TTCGAA 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 311
BssT1I CCWWGG 1 cut(s) 311
BstBI TTCGAA 1 cut(s) 56
BstDEI CTNAG 3 cut(s) 233, 296, 323
BstMAI GTCTC 1 cut(s) 127
BstSFI CTRYAG 1 cut(s) 117
BstV1I GCAGC 2 cut(s) 103, 146
BveI ACCTGC 1 cut(s) 14
CaiI CAGNNNCTG 1 cut(s) 125
CviJI RGCY 6 cut(s) 116, 137, 168, 188, 290, 330
CviKI_1 RGCY 6 cut(s) 116, 137, 168, 188, 290, 330
DdeI CTNAG 3 cut(s) 233, 296, 323
DraI TTTAAA 1 cut(s) 172
Eco130I CCWWGG 1 cut(s) 311
Eco32I GATATC 1 cut(s) 253
EcoRV GATATC 1 cut(s) 253
EcoT14I CCWWGG 1 cut(s) 311
ErhI CCWWGG 1 cut(s) 311
FaiI YATR 6 cut(s) 98, 103, 152, 154, 156, 262
Fnu4HI GCNGC 2 cut(s) 117, 135
Fsp4HI GCNGC 2 cut(s) 117, 135
FspBI CTAG 1 cut(s) 287
GluI GCNGC 2 cut(s) 117, 135
GsaI CCCAGC 1 cut(s) 188
HinfI GANTC 2 cut(s) 91, 229
Hpy188I TCNGA 2 cut(s) 236, 324
Hpy188III TCNNGA 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 23, 119
HpyF3I CTNAG 3 cut(s) 233, 296, 323
LmnI GCTCC 1 cut(s) 327
LpnPI CCDG 3 cut(s) 9, 111, 198
Lsp1109I GCAGC 2 cut(s) 103, 146
MaeI CTAG 1 cut(s) 287
MboII GAAGA 2 cut(s) 45, 89
MfeI CAATTG 1 cut(s) 239
MluCI AATT 2 cut(s) 17, 239
MnlI CCTC 2 cut(s) 271, 318
MroXI GAANNNNTTC 1 cut(s) 203
MseI TTAA 1 cut(s) 171
MunI CAATTG 1 cut(s) 239
NspV TTCGAA 1 cut(s) 56
PdmI GAANNNNTTC 1 cut(s) 203
PfeI GAWTC 2 cut(s) 91, 229
PflMI CCANNNNNTGG 1 cut(s) 224
PkrI GCNGC 2 cut(s) 118, 136
PspFI CCCAGC 1 cut(s) 184
PstI CTGCAG 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 125
SaqAI TTAA 1 cut(s) 171
SatI GCNGC 2 cut(s) 117, 135
SetI ASST 5 cut(s) 28, 118, 139, 190, 332
SfcI CTRYAG 1 cut(s) 117
SfuI TTCGAA 1 cut(s) 56
SgeI CNNG 9 cut(s) 36, 80, 84, 138, 197, 205, 259, 299, 324
Sse9I AATT 2 cut(s) 17, 239
SspMI CTAG 1 cut(s) 287
StyI CCWWGG 1 cut(s) 311
TaqI TCGA 1 cut(s) 56
TasI AATT 2 cut(s) 17, 239
TfiI GAWTC 2 cut(s) 91, 229
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TseI GCWGC 2 cut(s) 116, 134
TspDTI ATGAA 2 cut(s) 104, 249
TspGWI ACGGA 1 cut(s) 318
Van91I CCANNNNNTGG 1 cut(s) 224
XmnI GAANNNNTTC 1 cut(s) 203
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.