Rroxscaffold_1G00048440

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
68400403 .. 68402626
2224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00048440.1

Sequence Viewer

Length: 150 bp
ATGCAAACTGATATTGCTAAGAAAATACCCCAAAGCTTACCAACATTTGGGAATCTCAGGAAATTGAACTTGGACCTCCTTTCATACCAAAATAAAAGTGAGGAAGCATCGAAGCCAAAAAGGTTAAAAGCTGAATGCCACCAGTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.66

Weight (kDa)

9.58

Isoelectric Point (pI)

58.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 47
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 1 cut(s) 67
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
AluBI AGCT 2 cut(s) 36, 131
AluI AGCT 2 cut(s) 36, 131
AspS9I GGNCC 1 cut(s) 73
AvaII GGWCC 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 73
BmsI GCATC 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 47
BsmI GAATGC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 69
BsrI ACTGG 1 cut(s) 142
BstDEI CTNAG 2 cut(s) 18, 56
Cfr13I GGNCC 1 cut(s) 73
CviJI RGCY 3 cut(s) 36, 115, 131
CviKI_1 RGCY 3 cut(s) 36, 115, 131
DdeI CTNAG 2 cut(s) 18, 56
Eco47I GGWCC 1 cut(s) 73
FaiI YATR 1 cut(s) 85
HindIII AAGCTT 1 cut(s) 34
HinfI GANTC 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 2 cut(s) 18, 56
LpnPI CCDG 1 cut(s) 43
LweI GCATC 1 cut(s) 116
MluCI AATT 1 cut(s) 62
MnlI CCTC 2 cut(s) 86, 94
MseI TTAA 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 140
PctI GAATGC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 52
PflMI CCANNNNNTGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 73
SaqAI TTAA 1 cut(s) 125
Sau96I GGNCC 1 cut(s) 73
SetI ASST 4 cut(s) 38, 78, 125, 133
SfaNI GCATC 1 cut(s) 116
SgeI CNNG 2 cut(s) 70, 82
SinI GGWCC 1 cut(s) 73
Sse9I AATT 1 cut(s) 62
TaqI TCGA 1 cut(s) 110
TasI AATT 1 cut(s) 62
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 47
VpaK11BI GGWCC 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.