RchiOBHm_Chr5g0040001

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
34702965 .. 34703972
1008 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31853

Sequence Viewer

Length: 294 bp
ATGGATATTGATATTGAGGAACAGCGCTTAGGAGAAAAAGGTAAAGGTGTTAATGGAAAACTACTCCACTATAAGGGAACGCCATTTCATCGTATCGTATCTGGGTTCATGATTCAAGGCGGAGATATCATTCATGGTGATGGGAAGGGATATGAATTGATATATGGTGGCACTTTTGCTGATGAGAATTTCAAAGTGAAACATTCACATGCAGGTACTGTTTCTATGGTGAATACAGGACCTGATTCCAATTGCTCACAGTTCTTTATCACCACAATCAAGGCTAGTTCATAA

Protein Analysis

97

Amino Acids

10.53

Weight (kDa)

6.49

Isoelectric Point (pI)

11.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 23 - 94 1.2e-19 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 203
AciI CCGC 1 cut(s) 120
AcsI RAATTY 1 cut(s) 187
AfaI GTAC 1 cut(s) 217
AfeI AGCGCT 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 73
AgsI TTSAA 2 cut(s) 116, 193
AlwNI CAGNNNCTG 2 cut(s) 218, 242
Aor51HI AGCGCT 1 cut(s) 26
ApoI RAATTY 1 cut(s) 187
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 239
AsuHPI GGTGA 3 cut(s) 149, 241, 262
AvaII GGWCC 1 cut(s) 239
BccI CCATC 1 cut(s) 134
BfaI CTAG 1 cut(s) 285
BfoI RGCGCY 1 cut(s) 28
BfuAI ACCTGC 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 239
BmgT120I GGNCC 1 cut(s) 239
Bpu10I CCTNAGC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 73
BspACI CCGC 1 cut(s) 120
BspHI TCATGA 1 cut(s) 108
BspMI ACCTGC 1 cut(s) 203
Bst4CI ACNGT 2 cut(s) 220, 261
BstDEI CTNAG 1 cut(s) 28
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstNSI RCATGY 1 cut(s) 212
BveI ACCTGC 1 cut(s) 203
CaiI CAGNNNCTG 2 cut(s) 218, 242
CciI TCATGA 1 cut(s) 108
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 239
Csp6I GTAC 1 cut(s) 216
CviAII CATG 3 cut(s) 109, 134, 209
CviJI RGCY 1 cut(s) 284
CviKI_1 RGCY 1 cut(s) 284
CviQI GTAC 1 cut(s) 216
DdeI CTNAG 1 cut(s) 28
EciI GGCGGA 1 cut(s) 135
Eco32I GATATC 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 239
Eco47III AGCGCT 1 cut(s) 26
EcoO109I RGGNCCY 1 cut(s) 239
EcoRV GATATC 1 cut(s) 127
FaeI CATG 3 cut(s) 112, 137, 212
FaiI YATR 9 cut(s) 72, 110, 135, 153, 163, 165, 210, 227, 292
FatI CATG 3 cut(s) 108, 133, 208
FspBI CTAG 1 cut(s) 285
GlaI GCGC 1 cut(s) 26
HaeII RGCGCY 1 cut(s) 28
HhaI GCGC 1 cut(s) 27
Hin1II CATG 3 cut(s) 112, 137, 212
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 2 cut(s) 112, 245
HphI GGTGA 3 cut(s) 149, 241, 262
Hpy188III TCNNGA 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 139
HpyCH4III ACNGT 2 cut(s) 220, 261
HpyCH4V TGCA 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 3 cut(s) 112, 137, 212
HspAI GCGC 1 cut(s) 25
LpnPI CCDG 4 cut(s) 87, 198, 222, 255
MaeI CTAG 1 cut(s) 285
MfeI CAATTG 1 cut(s) 250
MluCI AATT 3 cut(s) 155, 187, 250
MnlI CCTC 1 cut(s) 10
MseI TTAA 1 cut(s) 51
MslI CAYNNNNRTG 2 cut(s) 138, 207
MunI CAATTG 1 cut(s) 250
NlaIII CATG 3 cut(s) 112, 137, 212
NspI RCATGY 1 cut(s) 212
PagI TCATGA 1 cut(s) 108
PfeI GAWTC 2 cut(s) 112, 245
PpuMI RGGWCCY 1 cut(s) 239
Psp5II RGGWCCY 1 cut(s) 239
PspPI GGNCC 1 cut(s) 239
PspPPI RGGWCCY 1 cut(s) 239
PstNI CAGNNNCTG 2 cut(s) 218, 242
RsaI GTAC 1 cut(s) 217
RsaNI GTAC 1 cut(s) 216
RseI CAYNNNNRTG 2 cut(s) 138, 207
SaqAI TTAA 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 239
SetI ASST 4 cut(s) 43, 49, 217, 244
SgeI CNNG 8 cut(s) 114, 121, 128, 146, 221, 225, 249, 254
SinI GGWCC 1 cut(s) 239
SmiMI CAYNNNNRTG 2 cut(s) 138, 207
Sse9I AATT 3 cut(s) 155, 187, 250
SsiI CCGC 1 cut(s) 120
SspMI CTAG 1 cut(s) 285
TaaI ACNGT 2 cut(s) 220, 261
TasI AATT 3 cut(s) 155, 187, 250
TfiI GAWTC 2 cut(s) 112, 245
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 5 cut(s) 77, 97, 122, 168, 279
VpaK11BI GGWCC 1 cut(s) 239
XapI RAATTY 1 cut(s) 187
XceI RCATGY 1 cut(s) 212
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.