Rroxscaffold_7G00216070

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
66789515 .. 66792634
3120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00216070.1

Sequence Viewer

Length: 345 bp
ATGATTCAAGGCGGAGATATCATTCATGGTGATGGGAAGGGATATGAATCGATATATGGTGGCACCTTTGCTGATGAGAATTTCAAAGTGAAACATTCACATGCAGGTACTGTTTCTATGGTGAATACAGGACCTGATTCCAATGGGTCACAGTTCTTTATCACCACAATCAAGGCTAGTTGGTTGGATGGGGAGCATGTCGTCTTCGGCAAGGTTATACAGGGCATGGACATGGTGTATGCAATTGAAGGAGGGGCTGGAACCTACAGTGGAAAGCCCAGAAAGAAGGTTGTTATTGCTGACTCAGGAGAAATACCCAAGGACAAGTGGGATGAGGAAAGATGA

Protein Analysis

114

Amino Acids

12.3

Weight (kDa)

5.46

Isoelectric Point (pI)

8.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 1 - 102 1e-27 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 95
AccB1I GGYRCC 1 cut(s) 62
AciI CCGC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 79
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 3 cut(s) 8, 85, 248
AlwNI CAGNNNCTG 2 cut(s) 110, 134
ApoI RAATTY 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 131
AsuHPI GGTGA 3 cut(s) 41, 133, 154
AvaII GGWCC 1 cut(s) 131
BanI GGYRCC 1 cut(s) 62
BbsI GAAGAC 1 cut(s) 196
BccI CCATC 2 cut(s) 26, 182
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 265
BfuAI ACCTGC 1 cut(s) 95
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BmiI GGNNCC 2 cut(s) 64, 262
BpiI GAAGAC 1 cut(s) 196
Bsa29I ATCGAT 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 318
Bse8I GATNNNNATC 1 cut(s) 46
BseCI ATCGAT 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 318
BseGI GGATG 2 cut(s) 193, 337
BseJI GATNNNNATC 1 cut(s) 46
BseMII CTCAG 1 cut(s) 318
BshNI GGYRCC 1 cut(s) 62
BshVI ATCGAT 1 cut(s) 50
BspACI CCGC 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 317
BspDI ATCGAT 1 cut(s) 50
BspLI GGNNCC 2 cut(s) 64, 262
BspMI ACCTGC 1 cut(s) 95
BspT107I GGYRCC 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 318
BssT1I CCWWGG 1 cut(s) 318
Bst4CI ACNGT 3 cut(s) 112, 153, 269
BstDEI CTNAG 1 cut(s) 304
BstF5I GGATG 2 cut(s) 193, 337
BstNSI RCATGY 2 cut(s) 104, 200
BstSFI CTRYAG 1 cut(s) 265
BstV2I GAAGAC 1 cut(s) 196
Bsu15I ATCGAT 1 cut(s) 50
BsuTUI ATCGAT 1 cut(s) 50
BtsCI GGATG 2 cut(s) 193, 337
BtsIMutI CAGTG 1 cut(s) 274
BveI ACCTGC 1 cut(s) 95
CaiI CAGNNNCTG 2 cut(s) 110, 134
Cfr13I GGNCC 1 cut(s) 131
ClaI ATCGAT 1 cut(s) 50
Csp6I GTAC 1 cut(s) 108
CviAII CATG 5 cut(s) 26, 101, 197, 226, 232
CviJI RGCY 3 cut(s) 176, 257, 277
CviKI_1 RGCY 3 cut(s) 176, 257, 277
CviQI GTAC 1 cut(s) 108
DdeI CTNAG 1 cut(s) 304
EciI GGCGGA 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 318
Eco32I GATATC 1 cut(s) 19
Eco47I GGWCC 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 131
EcoRV GATATC 1 cut(s) 19
EcoT14I CCWWGG 1 cut(s) 318
ErhI CCWWGG 1 cut(s) 318
FaeI CATG 5 cut(s) 29, 104, 200, 229, 235
FatI CATG 5 cut(s) 25, 100, 196, 225, 231
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 177
Hin1II CATG 5 cut(s) 29, 104, 200, 229, 235
HinfI GANTC 4 cut(s) 4, 47, 137, 302
HphI GGTGA 3 cut(s) 41, 133, 154
Hpy188III TCNNGA 1 cut(s) 306
HpyAV CCTTC 3 cut(s) 31, 242, 280
HpyCH4III ACNGT 3 cut(s) 112, 153, 269
HpyCH4V TGCA 2 cut(s) 104, 242
HpyF3I CTNAG 1 cut(s) 304
Hsp92II CATG 5 cut(s) 29, 104, 200, 229, 235
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 7 cut(s) 90, 114, 147, 206, 243, 291, 292
MaeI CTAG 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 147
MboII GAAGA 1 cut(s) 196
MfeI CAATTG 1 cut(s) 243
MluCI AATT 2 cut(s) 79, 243
MlyI GAGTC 1 cut(s) 296
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 2 cut(s) 245, 328
MslI CAYNNNNRTG 3 cut(s) 30, 99, 230
MunI CAATTG 1 cut(s) 243
NlaIII CATG 5 cut(s) 29, 104, 200, 229, 235
NlaIV GGNNCC 2 cut(s) 64, 262
NmuCI GTSAC 1 cut(s) 147
NspI RCATGY 2 cut(s) 104, 200
PfeI GAWTC 3 cut(s) 4, 47, 137
PleI GAGTC 1 cut(s) 296
PpsI GAGTC 1 cut(s) 296
PpuMI RGGWCCY 1 cut(s) 131
Psp5II RGGWCCY 1 cut(s) 131
PspN4I GGNNCC 2 cut(s) 64, 262
PspPI GGNCC 1 cut(s) 131
PspPPI RGGWCCY 1 cut(s) 131
PstNI CAGNNNCTG 2 cut(s) 110, 134
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
RseI CAYNNNNRTG 3 cut(s) 30, 99, 230
Sau96I GGNCC 1 cut(s) 131
SchI GAGTC 1 cut(s) 296
SetI ASST 6 cut(s) 68, 109, 136, 216, 266, 291
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 1 cut(s) 131
SmiMI CAYNNNNRTG 3 cut(s) 30, 99, 230
Sse9I AATT 2 cut(s) 79, 243
SsiI CCGC 1 cut(s) 12
SspMI CTAG 1 cut(s) 177
StyI CCWWGG 1 cut(s) 318
TaaI ACNGT 3 cut(s) 112, 153, 269
TaqI TCGA 1 cut(s) 50
TasI AATT 2 cut(s) 79, 243
TfiI GAWTC 3 cut(s) 4, 47, 137
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 1 cut(s) 147
Tsp45I GTSAC 1 cut(s) 147
TspDTI ATGAA 2 cut(s) 14, 60
TspRI CASTG 1 cut(s) 274
VpaK11BI GGWCC 1 cut(s) 131
XapI RAATTY 1 cut(s) 79
XceI RCATGY 2 cut(s) 104, 200
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.