RchiOBHm_Chr5g0045011

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
40621748 .. 40622729
982 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32315

Sequence Viewer

Length: 327 bp
ATGCCAATACTTGCATGTAGAATTATGATTGGATTATACGGTCAGGTTGTACCAAAAAATGTTGGAGAAAAAGGTAAAAGTGTTAATGGAAAACTACTCCACTATAAGGGAACGCCATTTCATCGTATCGTATCTGGGTTCATGATTCAAGGCGGAGATATCATTCATGGTGATGGGAAGGGATATGAATCGATATATGGTGGCACTTTTGCTTATGAGAATTTGAAAGTGAAACATTCACATGCAGGTACTATTTCTATAGTGAATACAGGACCTGATTCCAATGGCTCACAGTTCTTTATCACCACAATCAAAGCTAGTTCGTAA

Protein Analysis

108

Amino Acids

11.56

Weight (kDa)

9.48

Isoelectric Point (pI)

14.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pro_isomerase PF00160 7 - 105 1e-20 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 236
AciI CCGC 1 cut(s) 153
AcsI RAATTY 1 cut(s) 220
AfaI GTAC 2 cut(s) 51, 250
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 149, 226
AluBI AGCT 1 cut(s) 317
AluI AGCT 1 cut(s) 317
AlwNI CAGNNNCTG 1 cut(s) 275
ApoI RAATTY 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 272
AsuHPI GGTGA 2 cut(s) 182, 295
AvaII GGWCC 1 cut(s) 272
BccI CCATC 1 cut(s) 167
BfaI CTAG 1 cut(s) 318
BfmI CTRYAG 1 cut(s) 258
BfuAI ACCTGC 1 cut(s) 236
Bme18I GGWCC 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 272
Bsa29I ATCGAT 1 cut(s) 191
BsaBI GATNNNNATC 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse8I GATNNNNATC 1 cut(s) 187
BseCI ATCGAT 1 cut(s) 191
BseJI GATNNNNATC 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 106
BshVI ATCGAT 1 cut(s) 191
BslI CCNNNNNNNGG 1 cut(s) 106
BspACI CCGC 1 cut(s) 153
BspDI ATCGAT 1 cut(s) 191
BspHI TCATGA 1 cut(s) 141
BspMI ACCTGC 1 cut(s) 236
Bst4CI ACNGT 2 cut(s) 41, 294
BstNSI RCATGY 2 cut(s) 18, 245
BstSFI CTRYAG 1 cut(s) 258
Bsu15I ATCGAT 1 cut(s) 191
BsuTUI ATCGAT 1 cut(s) 191
BveI ACCTGC 1 cut(s) 236
CaiI CAGNNNCTG 1 cut(s) 275
CciI TCATGA 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 272
ClaI ATCGAT 1 cut(s) 191
Csp6I GTAC 2 cut(s) 50, 249
CviAII CATG 4 cut(s) 15, 142, 167, 242
CviJI RGCY 2 cut(s) 288, 317
CviKI_1 RGCY 2 cut(s) 288, 317
CviQI GTAC 2 cut(s) 50, 249
EciI GGCGGA 1 cut(s) 168
Eco32I GATATC 1 cut(s) 160
Eco47I GGWCC 1 cut(s) 272
EcoO109I RGGNCCY 1 cut(s) 272
EcoRV GATATC 1 cut(s) 160
FaeI CATG 4 cut(s) 18, 145, 170, 245
FatI CATG 4 cut(s) 14, 141, 166, 241
FspBI CTAG 1 cut(s) 318
Hin1II CATG 4 cut(s) 18, 145, 170, 245
HinfI GANTC 3 cut(s) 145, 188, 278
HphI GGTGA 2 cut(s) 182, 295
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 2 cut(s) 41, 294
HpyCH4V TGCA 2 cut(s) 14, 245
Hsp92II CATG 4 cut(s) 18, 145, 170, 245
LpnPI CCDG 5 cut(s) 29, 120, 231, 255, 288
MaeI CTAG 1 cut(s) 318
MluCI AATT 2 cut(s) 21, 220
MmeI TCCRAC 1 cut(s) 43
MseI TTAA 1 cut(s) 84
MslI CAYNNNNRTG 2 cut(s) 171, 240
NlaIII CATG 4 cut(s) 18, 145, 170, 245
NspI RCATGY 2 cut(s) 18, 245
PagI TCATGA 1 cut(s) 141
PfeI GAWTC 3 cut(s) 145, 188, 278
PpuMI RGGWCCY 1 cut(s) 272
Psp5II RGGWCCY 1 cut(s) 272
PspPI GGNCC 1 cut(s) 272
PspPPI RGGWCCY 1 cut(s) 272
PstNI CAGNNNCTG 1 cut(s) 275
RsaI GTAC 2 cut(s) 51, 250
RsaNI GTAC 2 cut(s) 50, 249
RseI CAYNNNNRTG 2 cut(s) 171, 240
SaqAI TTAA 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 272
SetI ASST 5 cut(s) 48, 76, 250, 277, 319
SfcI CTRYAG 1 cut(s) 258
SinI GGWCC 1 cut(s) 272
SmiMI CAYNNNNRTG 2 cut(s) 171, 240
Sse9I AATT 2 cut(s) 21, 220
SsiI CCGC 1 cut(s) 153
SspMI CTAG 1 cut(s) 318
TaaI ACNGT 2 cut(s) 41, 294
TaqI TCGA 1 cut(s) 191
TasI AATT 2 cut(s) 21, 220
TfiI GAWTC 3 cut(s) 145, 188, 278
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspDTI ATGAA 4 cut(s) 110, 130, 155, 201
VpaK11BI GGWCC 1 cut(s) 272
XapI RAATTY 1 cut(s) 220
XceI RCATGY 2 cut(s) 18, 245
XspI CTAG 1 cut(s) 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.