Rmu_sc0003757.1_g000003

PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003757.1
Physical Location & Seq
Forward (+)
8093 .. 10355
2263 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003757.1_g000003.1.cds

Sequence Viewer

Length: 429 bp
atgttgtatcaaaaaattttactttctcaatccgaatttgctactacctatgacaaagaaccccaaagtagcaatctcaactccaaagccttcctggttctccccgaaaaggaggaagagaaagtagaagaagtacttgaaataacccatagagtatacatggatattgatattgaggaacaactcataggtagaattgtgattggattatacggtcaggttgcaccaaaaaatgttggagaaaaaggtaaaggtgttaatggaaaactactccactataagggaactccatttcatcgtatcgtatctgggttcatgattcaaggcggagatatcattcatggtgatgggaagggatatgaatcgatatatggtggcacttttgcttatgagaatttcaaagtgaaacattcacatgcaggtgtttaa

Protein Analysis

142

Amino Acids

15.89

Weight (kDa)

6.06

Isoelectric Point (pI)

38.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 410
Acc36I ACCTGC 1 cut(s) 410
AccI GTMKAC 1 cut(s) 156
AciI CCGC 1 cut(s) 327
AcsI RAATTY 3 cut(s) 15, 35, 394
AfaI GTAC 1 cut(s) 135
AfiI CCNNNNNNNGG 2 cut(s) 109, 280
AgsI TTSAA 3 cut(s) 140, 323, 400
AjnI CCWGG 1 cut(s) 93
ApoI RAATTY 3 cut(s) 15, 35, 394
AsuHPI GGTGA 1 cut(s) 356
BccI CCATC 1 cut(s) 341
BciT130I CCWGG 1 cut(s) 95
BfuAI ACCTGC 1 cut(s) 410
BmcAI AGTACT 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 95
Bsa29I ATCGAT 1 cut(s) 365
BsaBI GATNNNNATC 1 cut(s) 361
Bsc4I CCNNNNNNNGG 2 cut(s) 109, 280
Bse8I GATNNNNATC 1 cut(s) 361
BseBI CCWGG 1 cut(s) 95
BseCI ATCGAT 1 cut(s) 365
BseJI GATNNNNATC 1 cut(s) 361
BseLI CCNNNNNNNGG 2 cut(s) 109, 280
BshVI ATCGAT 1 cut(s) 365
BslI CCNNNNNNNGG 2 cut(s) 109, 280
BspACI CCGC 1 cut(s) 327
BspDI ATCGAT 1 cut(s) 365
BspHI TCATGA 1 cut(s) 315
BspMI ACCTGC 1 cut(s) 410
BssNAI GTATAC 1 cut(s) 157
Bst1107I GTATAC 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 215
Bst6I CTCTTC 1 cut(s) 111
BstNI CCWGG 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 419
BstSCI CCNGG 1 cut(s) 93
BstZ17I GTATAC 1 cut(s) 157
Bsu15I ATCGAT 1 cut(s) 365
BsuTUI ATCGAT 1 cut(s) 365
BveI ACCTGC 1 cut(s) 410
CciI TCATGA 1 cut(s) 315
ClaI ATCGAT 1 cut(s) 365
Csp6I GTAC 1 cut(s) 134
CviAII CATG 4 cut(s) 160, 316, 341, 416
CviJI RGCY 1 cut(s) 89
CviKI_1 RGCY 1 cut(s) 89
CviQI GTAC 1 cut(s) 134
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
EciI GGCGGA 1 cut(s) 342
Eco32I GATATC 1 cut(s) 334
EcoRII CCWGG 1 cut(s) 93
EcoRV GATATC 1 cut(s) 334
FaeI CATG 4 cut(s) 163, 319, 344, 419
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FatI CATG 4 cut(s) 159, 315, 340, 415
FblI GTMKAC 1 cut(s) 156
Hin1II CATG 4 cut(s) 163, 319, 344, 419
HinfI GANTC 2 cut(s) 319, 362
HphI GGTGA 1 cut(s) 356
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 1 cut(s) 316
Hpy8I GTNNAC 1 cut(s) 157
HpyAV CCTTC 2 cut(s) 100, 346
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 224, 419
Hsp92II CATG 4 cut(s) 163, 319, 344, 419
LpnPI CCDG 5 cut(s) 80, 107, 203, 294, 405
MboII GAAGA 2 cut(s) 128, 140
MluCI AATT 4 cut(s) 15, 35, 195, 394
MmeI TCCRAC 1 cut(s) 217
MnlI CCTC 2 cut(s) 106, 169
MseI TTAA 2 cut(s) 258, 427
MslI CAYNNNNRTG 3 cut(s) 345, 414, 420
MspR9I CCNGG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 95
NlaIII CATG 4 cut(s) 163, 319, 344, 419
NspI RCATGY 1 cut(s) 419
PagI TCATGA 1 cut(s) 315
PaqCI CACCTGC 1 cut(s) 410
PfeI GAWTC 2 cut(s) 319, 362
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
RseI CAYNNNNRTG 3 cut(s) 345, 414, 420
SaqAI TTAA 2 cut(s) 258, 427
ScaI AGTACT 1 cut(s) 135
ScrFI CCNGG 1 cut(s) 95
SetI ASST 6 cut(s) 50, 193, 222, 250, 256, 424
SmiMI CAYNNNNRTG 3 cut(s) 345, 414, 420
Sse9I AATT 4 cut(s) 15, 35, 195, 394
SsiI CCGC 1 cut(s) 327
StyD4I CCNGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 215
TaqI TCGA 1 cut(s) 365
TasI AATT 4 cut(s) 15, 35, 195, 394
TatI WGTACW 1 cut(s) 133
TfiI GAWTC 2 cut(s) 319, 362
Tru1I TTAA 2 cut(s) 258, 427
Tru9I TTAA 2 cut(s) 258, 427
TspDTI ATGAA 4 cut(s) 284, 304, 329, 375
XapI RAATTY 3 cut(s) 15, 35, 394
XceI RCATGY 1 cut(s) 419
XcmI CCANNNNNNNNNTGG 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 156
ZrmI AGTACT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.