RchiOBHm_Chr5g0043671

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
38710369 .. 38712155
1787 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32193

Sequence Viewer

Length: 207 bp
ATGGTTCTGTTATTGATGATTGTGAATTCCTTTTCACACCAAAAATTGGACCCCCAGAGGAAGGTGAAATATTGTACTGTGAGTGAAAGGCCAACAACCAATGGTGCAGTAGTGAAAGGCCAAACACTGAAGTTGAAACGAAGATCCCCGGAGCATCAAGTTTATGAAAAGTTGAGGGCTGAGTGGCTGACCTTGATTTTTCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.01

Weight (kDa)

10.29

Isoelectric Point (pI)

33.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 46
AclWI GGATC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 25
AcuI CTGAAG 1 cut(s) 149
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 2 cut(s) 46, 61
AgsI TTSAA 1 cut(s) 136
AlwI GGATC 1 cut(s) 138
AoxI GGCC 2 cut(s) 89, 118
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 49
AsuC2I CCSGG 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 76
AvaII GGWCC 1 cut(s) 49
BcnI CCSGG 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BmiI GGNNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 163
BpuMI CCSGG 1 cut(s) 149
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 61
BseDI CCNNGG 1 cut(s) 147
BseLI CCNNNNNNNGG 2 cut(s) 46, 61
BseMII CTCAG 1 cut(s) 171
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 2 cut(s) 91, 120
BsiSI CCGG 1 cut(s) 149
BslI CCNNNNNNNGG 2 cut(s) 46, 61
BsnI GGCC 2 cut(s) 91, 120
Bsp143I GATC 1 cut(s) 143
BspANI GGCC 2 cut(s) 91, 120
BspCNI CTCAG 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 51
BspPI GGATC 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 1 cut(s) 143
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 180
BstKTI GATC 1 cut(s) 146
BstMBI GATC 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 147
BstX2I RGATCY 1 cut(s) 143
BstYI RGATCY 1 cut(s) 143
BsuRI GGCC 2 cut(s) 91, 120
BtsIMutI CAGTG 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 49
Csp6I GTAC 1 cut(s) 75
CviJI RGCY 4 cut(s) 91, 120, 179, 187
CviKI_1 RGCY 4 cut(s) 91, 120, 179, 187
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 145
DpnII GATC 1 cut(s) 143
Eco47I GGWCC 1 cut(s) 49
Eco57I CTGAAG 1 cut(s) 149
EcoRI GAATTC 1 cut(s) 25
FaiI YATR 1 cut(s) 165
HaeIII GGCC 2 cut(s) 91, 120
HapII CCGG 1 cut(s) 149
HpaII CCGG 1 cut(s) 149
HphI GGTGA 1 cut(s) 76
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 180
Kzo9I GATC 1 cut(s) 143
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 68, 162
LweI GCATC 1 cut(s) 163
MalI GATC 1 cut(s) 145
MboI GATC 1 cut(s) 143
MboII GAAGA 1 cut(s) 153
MflI RGATCY 1 cut(s) 143
MluCI AATT 2 cut(s) 25, 44
MnlI CCTC 2 cut(s) 51, 168
MspI CCGG 1 cut(s) 149
MspR9I CCNGG 1 cut(s) 149
NciI CCSGG 1 cut(s) 149
NdeII GATC 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 51
PflMI CCANNNNNTGG 1 cut(s) 46
PspN4I GGNNCC 1 cut(s) 51
PspPI GGNCC 1 cut(s) 49
PsuI RGATCY 1 cut(s) 143
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 143
Sau96I GGNCC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 149
SetI ASST 2 cut(s) 66, 194
SfaNI GCATC 1 cut(s) 163
SgeI CNNG 4 cut(s) 67, 160, 161, 170
SinI GGWCC 1 cut(s) 49
Sse9I AATT 2 cut(s) 25, 44
SspI AATATT 1 cut(s) 71
StyD4I CCNGG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 79
TasI AATT 2 cut(s) 25, 44
TatI WGTACW 1 cut(s) 74
TscAI CASTG 1 cut(s) 132
TspDTI ATGAA 1 cut(s) 180
TspRI CASTG 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 49
XapI RAATTY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.