RchiOBHm_Chr6g0248191

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
4194826 .. 4200169
5344 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22247

Sequence Viewer

Length: 165 bp
ATGGCTGATGCTCTAGCAGATATGAAAAAAGATGGTGCTTCACCTTCTGAAGGCCATCCTACAGTTAACCTAAAGAACAAACCTACTAAAGATGTCCACAAACATCCAGACACATCAAAACCAGCGTGGCTTTTGGCTTTGGAAGTAGTGACAAGAACCACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.85

Weight (kDa)

8.12

Isoelectric Point (pI)

26.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 50
AoxI GGCC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 33
BccI CCATC 2 cut(s) 26, 63
BfaI CTAG 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseGI GGATG 2 cut(s) 55, 103
BseLI CCNNNNNNNGG 1 cut(s) 50
BshFI GGCC 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 50
BsnI GGCC 1 cut(s) 54
BspANI GGCC 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 64
BstENI CCTNNNNNAGG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 55, 103
BstSFI CTRYAG 1 cut(s) 60
BsuRI GGCC 1 cut(s) 54
BtsCI GGATG 2 cut(s) 55, 103
CviJI RGCY 4 cut(s) 5, 54, 130, 137
CviKI_1 RGCY 4 cut(s) 5, 54, 130, 137
Eco57I CTGAAG 1 cut(s) 69
EcoNI CCTNNNNNAGG 1 cut(s) 48
FaiI YATR 1 cut(s) 23
FalI AAGNNNNNCTT 1 cut(s) 145
FokI GGATG 2 cut(s) 42, 90
FspBI CTAG 1 cut(s) 14
HaeIII GGCC 1 cut(s) 54
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HpaI GTTAAC 1 cut(s) 67
HphI GGTGA 1 cut(s) 33
Hpy166II GTNNAC 2 cut(s) 67, 97
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 67, 97
HpyAV CCTTC 2 cut(s) 44, 54
HpyCH4III ACNGT 1 cut(s) 64
KspAI GTTAAC 1 cut(s) 67
LpnPI CCDG 2 cut(s) 120, 135
MaeI CTAG 1 cut(s) 14
MaeIII GTNAC 1 cut(s) 148
MseI TTAA 2 cut(s) 66, 163
NmuCI GTSAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 66, 163
SetI ASST 3 cut(s) 46, 72, 85
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 4 cut(s) 26, 119, 134, 138
SspMI CTAG 1 cut(s) 14
TaaI ACNGT 1 cut(s) 64
Tru1I TTAA 2 cut(s) 66, 163
Tru9I TTAA 2 cut(s) 66, 163
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
TspDTI ATGAA 1 cut(s) 38
XagI CCTNNNNNAGG 1 cut(s) 48
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.