Rh1BG244700

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
37132302 .. 37134483
2182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG244700.1

Sequence Viewer

Length: 207 bp
ATGAGCCGTCATATATCGGATTGGGGTGAGAACAATATTGCCATTGCTGCTGAAACTACTGCTCCTTGGGCGTTGTTTCAGCAAGAAGAAGAAGAAGTTTGGCATAAGCTTGACCATCCAAATATTTCAAAGTTTGTTGGAGCTTCAATGGGAAGCTCGAATCTTAAAATCATTGCCAAAGGCACAAGAAGTGATGGTCAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.52

Weight (kDa)

5.44

Isoelectric Point (pI)

72.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 129, 147
AluBI AGCT 3 cut(s) 109, 143, 156
AluI AGCT 3 cut(s) 109, 143, 156
ApeKI GCWGC 1 cut(s) 47
AsuHPI GGTGA 1 cut(s) 38
BbvI GCAGC 1 cut(s) 34
BccI CCATC 2 cut(s) 123, 188
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BsaJI CCNNGG 1 cut(s) 65
BsaXI ACNNNNNCTCC 2 cut(s) 46, 76
Bse3DI GCAATG 2 cut(s) 42, 171
BseDI CCNNGG 1 cut(s) 65
BseGI GGATG 1 cut(s) 115
BseMI GCAATG 2 cut(s) 42, 171
BseXI GCAGC 1 cut(s) 34
BsrDI GCAATG 2 cut(s) 42, 171
BssECI CCNNGG 1 cut(s) 65
BssT1I CCWWGG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 115
BstMWI GCNNNNNNNGC 2 cut(s) 47, 68
BstV1I GCAGC 1 cut(s) 34
BtsCI GGATG 1 cut(s) 115
CviJI RGCY 4 cut(s) 6, 109, 143, 156
CviKI_1 RGCY 4 cut(s) 6, 109, 143, 156
Eco130I CCWWGG 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 65
ErhI CCWWGG 1 cut(s) 65
FaiI YATR 4 cut(s) 12, 14, 105, 205
Fnu4HI GCNGC 1 cut(s) 48
FokI GGATG 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 48
GluI GCNGC 1 cut(s) 48
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 160
HphI GGTGA 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 19
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 68
LmnI GCTCC 2 cut(s) 67, 140
Lsp1109I GCAGC 1 cut(s) 34
MboII GAAGA 3 cut(s) 98, 101, 104
MmeI TCCRAC 1 cut(s) 118
MseI TTAA 1 cut(s) 165
MwoI GCNNNNNNNGC 2 cut(s) 47, 68
PfeI GAWTC 1 cut(s) 160
PkrI GCNGC 1 cut(s) 49
SaqAI TTAA 1 cut(s) 165
SatI GCNGC 1 cut(s) 48
SetI ASST 3 cut(s) 111, 145, 158
SgeI CNNG 5 cut(s) 78, 95, 122, 169, 198
SspI AATATT 2 cut(s) 37, 124
StyI CCWWGG 1 cut(s) 65
TaqI TCGA 1 cut(s) 158
TfiI GAWTC 1 cut(s) 160
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseI GCWGC 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.