Rh6AG141300

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
21899709 .. 21900649
941 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG141300.1

Sequence Viewer

Length: 234 bp
ATGATTCTCAGCAACCATCTTAGGATATTGGATTGGGGTGAGAACAATATTGCCATTGCTGCTGCAACTACTGCTCCTGGGGCGTTGTTTCAGCAAGTTGTTGTTGTTTGGCATAAGCTTGACCATCCAGATATGTTTAAGCTTCAATGGGAAGTTCGAATCTTAAAATCATTGCCAAAGGCACATCAAGTGGTGGTCAGTCATAAGTCACCTCCCTGGAGTTCCAGAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.77

Weight (kDa)

9.4

Isoelectric Point (pI)

46.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 146
AjnI CCWGG 2 cut(s) 76, 215
AluBI AGCT 2 cut(s) 118, 142
AluI AGCT 2 cut(s) 118, 142
ApeKI GCWGC 2 cut(s) 59, 62
AsuHPI GGTGA 2 cut(s) 50, 201
AsuII TTCGAA 1 cut(s) 157
BbvI GCAGC 2 cut(s) 46, 49
BccI CCATC 2 cut(s) 24, 132
BciT130I CCWGG 2 cut(s) 78, 217
BisI GCNGC 2 cut(s) 60, 63
BlsI GCNGC 2 cut(s) 61, 64
Bme1390I CCNGG 2 cut(s) 78, 217
BmrFI CCNGG 2 cut(s) 78, 217
Bpu14I TTCGAA 1 cut(s) 157
BsaJI CCNNGG 2 cut(s) 77, 215
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
Bse3DI GCAATG 2 cut(s) 54, 170
BseBI CCWGG 2 cut(s) 78, 217
BseDI CCNNGG 2 cut(s) 77, 215
BseGI GGATG 1 cut(s) 124
BseMI GCAATG 2 cut(s) 54, 170
BseMII CTCAG 1 cut(s) 22
BseXI GCAGC 2 cut(s) 46, 49
Bsp119I TTCGAA 1 cut(s) 157
BspCNI CTCAG 1 cut(s) 21
BspT104I TTCGAA 1 cut(s) 157
BsrDI GCAATG 2 cut(s) 54, 170
BssECI CCNNGG 2 cut(s) 77, 215
Bst2UI CCWGG 2 cut(s) 78, 217
BstAPI GCANNNNNTGC 1 cut(s) 71
BstBI TTCGAA 1 cut(s) 157
BstDEI CTNAG 2 cut(s) 8, 20
BstF5I GGATG 1 cut(s) 124
BstMWI GCNNNNNNNGC 3 cut(s) 59, 71, 80
BstNI CCWGG 2 cut(s) 78, 217
BstSCI CCNGG 2 cut(s) 76, 215
BstV1I GCAGC 2 cut(s) 46, 49
BtsCI GGATG 1 cut(s) 124
CviJI RGCY 2 cut(s) 118, 142
CviKI_1 RGCY 2 cut(s) 118, 142
DdeI CTNAG 2 cut(s) 8, 20
EcoRII CCWGG 2 cut(s) 76, 215
FaiI YATR 3 cut(s) 114, 134, 204
Fnu4HI GCNGC 2 cut(s) 60, 63
FokI GGATG 1 cut(s) 111
Fsp4HI GCNGC 2 cut(s) 60, 63
GluI GCNGC 2 cut(s) 60, 63
HindIII AAGCTT 2 cut(s) 116, 140
HinfI GANTC 2 cut(s) 4, 159
HphI GGTGA 2 cut(s) 50, 201
Hpy188III TCNNGA 2 cut(s) 128, 225
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 3 cut(s) 59, 71, 80
HpyF3I CTNAG 2 cut(s) 8, 20
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 5 cut(s) 63, 90, 141, 202, 229
Lsp1109I GCAGC 2 cut(s) 46, 49
MaeIII GTNAC 1 cut(s) 207
MnlI CCTC 1 cut(s) 222
MseI TTAA 3 cut(s) 138, 164, 232
MspR9I CCNGG 2 cut(s) 78, 217
MvaI CCWGG 2 cut(s) 78, 217
MwoI GCNNNNNNNGC 3 cut(s) 59, 71, 80
NmuCI GTSAC 1 cut(s) 207
NspV TTCGAA 1 cut(s) 157
PfeI GAWTC 2 cut(s) 4, 159
PkrI GCNGC 2 cut(s) 61, 64
Psp6I CCWGG 2 cut(s) 76, 215
PspGI CCWGG 2 cut(s) 76, 215
SaqAI TTAA 3 cut(s) 138, 164, 232
SatI GCNGC 2 cut(s) 60, 63
ScrFI CCNGG 2 cut(s) 78, 217
SetI ASST 3 cut(s) 120, 144, 214
SfuI TTCGAA 1 cut(s) 157
SgeI CNNG 8 cut(s) 89, 90, 107, 131, 140, 200, 228, 229
SspI AATATT 1 cut(s) 49
StyD4I CCNGG 2 cut(s) 76, 215
TaqI TCGA 1 cut(s) 157
TfiI GAWTC 2 cut(s) 4, 159
Tru1I TTAA 3 cut(s) 138, 164, 232
Tru9I TTAA 3 cut(s) 138, 164, 232
TseFI GTSAC 1 cut(s) 207
TseI GCWGC 2 cut(s) 59, 62
Tsp45I GTSAC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.