Rh7BG367100

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0003702
Physical Location & Seq
Reverse (-)
39233118 .. 39239291
6174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG367100.1

Sequence Viewer

Length: 426 bp
ATGTTGAAAACTCCAGCGCTCAATAAAGGTTTGGCCGAAAATCTCCCAACTGCTGGTGGAGCTGGGAGTAGCACAGCAGGTCGAAAAGGCATGGCTGATGCTCTAGCAGATATGAAAAAAGATGGTGCTTCACCTTCTGAAGGCCATCCTACAGTTAACCTAAAGAACAAACCTACTAAAGATGTCCACAAACATCCAGACACATCAAAACCAGCGTGGCTTTTGGCTTTGGAAATATTGGATTGGGGTGAGAACAATATTGCCATTGCTGCTGCAACCACTGCTCCTGGGGCGTTGTTTCAGCAAGTTGTTGTTGTTTGGCATAAGCTTGACCATCCAGATATTTCGAAGTTTGTTGGAGCTTCAATGGGAAGTTCGAATCTTAAAATCATTGCCAAAGGCACATCAAGTGGTGGTCAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase_Tyr

Protein Analysis

141

Amino Acids

14.53

Weight (kDa)

9.22

Isoelectric Point (pI)

32.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 68
AccB7I CCANNNNNTGG 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 33
AcuI CTGAAG 1 cut(s) 159
AfeI AGCGCT 1 cut(s) 18
AfiI CCNNNNNNNGG 2 cut(s) 53, 140
AgsI TTSAA 2 cut(s) 7, 366
AjnI CCWGG 1 cut(s) 286
AluBI AGCT 3 cut(s) 62, 328, 362
AluI AGCT 3 cut(s) 62, 328, 362
Aor51HI AGCGCT 1 cut(s) 18
AoxI GGCC 2 cut(s) 33, 142
ApeKI GCWGC 2 cut(s) 269, 272
AspLEI GCGC 1 cut(s) 19
AsuHPI GGTGA 2 cut(s) 123, 260
AsuII TTCGAA 2 cut(s) 347, 377
BbvI GCAGC 2 cut(s) 256, 259
BccI CCATC 3 cut(s) 116, 153, 342
BciT130I CCWGG 1 cut(s) 288
BfaI CTAG 1 cut(s) 104
BfmI CTRYAG 1 cut(s) 150
BfoI RGCGCY 1 cut(s) 20
BfuAI ACCTGC 1 cut(s) 68
BisI GCNGC 2 cut(s) 270, 273
BlsI GCNGC 2 cut(s) 271, 274
Bme1390I CCNGG 1 cut(s) 288
BmrFI CCNGG 1 cut(s) 288
BmsI GCATC 1 cut(s) 88
Bpu14I TTCGAA 2 cut(s) 347, 377
BsaJI CCNNGG 1 cut(s) 287
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 140
Bse3DI GCAATG 2 cut(s) 264, 390
BseBI CCWGG 1 cut(s) 288
BseDI CCNNGG 1 cut(s) 287
BseGI GGATG 3 cut(s) 145, 193, 334
BseLI CCNNNNNNNGG 2 cut(s) 53, 140
BseMI GCAATG 2 cut(s) 264, 390
BseXI GCAGC 2 cut(s) 256, 259
BseYI CCCAGC 1 cut(s) 62
BshFI GGCC 2 cut(s) 35, 144
BslI CCNNNNNNNGG 2 cut(s) 53, 140
BsnI GGCC 2 cut(s) 35, 144
Bsp119I TTCGAA 2 cut(s) 347, 377
BspANI GGCC 2 cut(s) 35, 144
BspMI ACCTGC 1 cut(s) 68
BspT104I TTCGAA 2 cut(s) 347, 377
BsrDI GCAATG 2 cut(s) 264, 390
BssECI CCNNGG 1 cut(s) 287
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 1 cut(s) 154
BstAPI GCANNNNNTGC 1 cut(s) 281
BstBI TTCGAA 2 cut(s) 347, 377
BstENI CCTNNNNNAGG 1 cut(s) 138
BstF5I GGATG 3 cut(s) 145, 193, 334
BstH2I RGCGCY 1 cut(s) 20
BstHHI GCGC 1 cut(s) 19
BstMWI GCNNNNNNNGC 4 cut(s) 59, 269, 281, 290
BstNI CCWGG 1 cut(s) 288
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 150
BstV1I GCAGC 2 cut(s) 256, 259
BsuRI GGCC 2 cut(s) 35, 144
BtsCI GGATG 3 cut(s) 145, 193, 334
BtsI GCAGTG 1 cut(s) 279
BtsIMutI CAGTG 1 cut(s) 279
BveI ACCTGC 1 cut(s) 68
CfoI GCGC 1 cut(s) 19
CviAII CATG 1 cut(s) 91
CviJI RGCY 8 cut(s) 35, 62, 95, 144, 220, 227, 328, 362
CviKI_1 RGCY 8 cut(s) 35, 62, 95, 144, 220, 227, 328, 362
EaeI YGGCCR 1 cut(s) 33
Eco47III AGCGCT 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 159
EcoNI CCTNNNNNAGG 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 286
FaeI CATG 1 cut(s) 94
FaiI YATR 4 cut(s) 92, 113, 324, 424
FatI CATG 1 cut(s) 90
Fnu4HI GCNGC 2 cut(s) 270, 273
FokI GGATG 3 cut(s) 132, 180, 321
Fsp4HI GCNGC 2 cut(s) 270, 273
FspBI CTAG 1 cut(s) 104
GlaI GCGC 1 cut(s) 18
GluI GCNGC 2 cut(s) 270, 273
GsaI CCCAGC 1 cut(s) 66
HaeII RGCGCY 1 cut(s) 20
HaeIII GGCC 2 cut(s) 35, 144
HhaI GCGC 1 cut(s) 19
Hin1II CATG 1 cut(s) 94
Hin6I GCGC 1 cut(s) 17
HinP1I GCGC 1 cut(s) 17
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HindIII AAGCTT 1 cut(s) 326
HinfI GANTC 1 cut(s) 379
HpaI GTTAAC 1 cut(s) 157
HphI GGTGA 2 cut(s) 123, 260
Hpy166II GTNNAC 2 cut(s) 157, 187
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 197, 338
Hpy8I GTNNAC 2 cut(s) 157, 187
HpyAV CCTTC 2 cut(s) 134, 144
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 275
HpyF10VI GCNNNNNNNGC 4 cut(s) 59, 269, 281, 290
Hsp92II CATG 1 cut(s) 94
HspAI GCGC 1 cut(s) 17
KspAI GTTAAC 1 cut(s) 157
LmnI GCTCC 3 cut(s) 59, 289, 359
LpnPI CCDG 9 cut(s) 27, 39, 48, 63, 210, 225, 273, 300, 351
Lsp1109I GCAGC 2 cut(s) 256, 259
LweI GCATC 1 cut(s) 88
MaeI CTAG 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 337
MseI TTAA 2 cut(s) 156, 384
MspR9I CCNGG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 4 cut(s) 59, 269, 281, 290
NlaIII CATG 1 cut(s) 94
NspV TTCGAA 2 cut(s) 347, 377
PfeI GAWTC 1 cut(s) 379
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 2 cut(s) 271, 274
Psp6I CCWGG 1 cut(s) 286
PspFI CCCAGC 1 cut(s) 62
PspGI CCWGG 1 cut(s) 286
SaqAI TTAA 2 cut(s) 156, 384
SatI GCNGC 2 cut(s) 270, 273
ScrFI CCNGG 1 cut(s) 288
SetI ASST 8 cut(s) 31, 64, 82, 136, 162, 175, 330, 364
SfaNI GCATC 1 cut(s) 88
SfcI CTRYAG 1 cut(s) 150
SfuI TTCGAA 2 cut(s) 347, 377
SspI AATATT 2 cut(s) 237, 259
SspMI CTAG 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 286
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 3 cut(s) 82, 347, 377
TfiI GAWTC 1 cut(s) 379
Tru1I TTAA 2 cut(s) 156, 384
Tru9I TTAA 2 cut(s) 156, 384
TscAI CASTG 1 cut(s) 286
TseI GCWGC 2 cut(s) 269, 272
TspDTI ATGAA 1 cut(s) 128
TspRI CASTG 1 cut(s) 286
Van91I CCANNNNNTGG 1 cut(s) 53
XagI CCTNNNNNAGG 1 cut(s) 138
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.