Rh7BG337700

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
35218345 .. 35224169
5825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG337700.1

Sequence Viewer

Length: 216 bp
ATGAATGGGCAGGTTGTAAAGCAAATATTGGATTGGGGTGAGAACAATATTGCCATTGCTGCTGCAACTACTGCTCCTGGGGCGTTGTTTCAGCAAGTTGTTGTTGTTTGGCATAAGCTTGACCATCCAGATATTTCGAAGTTTGTTGGAGCTTCAATGGGAAGTTCGAATCTTAAAATCATTGCCAAAGGCACATCAAGTGGTGGCCAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.39

Weight (kDa)

8.18

Isoelectric Point (pI)

29.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 205
AgsI TTSAA 1 cut(s) 156
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 2 cut(s) 118, 152
AluI AGCT 2 cut(s) 118, 152
AoxI GGCC 1 cut(s) 205
ApeKI GCWGC 2 cut(s) 59, 62
AsuHPI GGTGA 1 cut(s) 50
AsuII TTCGAA 2 cut(s) 137, 167
BalI TGGCCA 1 cut(s) 207
BbvI GCAGC 2 cut(s) 46, 49
BccI CCATC 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 78
BisI GCNGC 2 cut(s) 60, 63
BlsI GCNGC 2 cut(s) 61, 64
Bme1390I CCNGG 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 78
Bpu14I TTCGAA 2 cut(s) 137, 167
BsaJI CCNNGG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
Bse1I ACTGG 1 cut(s) 208
Bse3DI GCAATG 2 cut(s) 54, 180
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 124
BseMI GCAATG 2 cut(s) 54, 180
BseNI ACTGG 1 cut(s) 208
BseXI GCAGC 2 cut(s) 46, 49
BshFI GGCC 1 cut(s) 207
BsnI GGCC 1 cut(s) 207
Bsp119I TTCGAA 2 cut(s) 137, 167
BspANI GGCC 1 cut(s) 207
BspT104I TTCGAA 2 cut(s) 137, 167
BsrDI GCAATG 2 cut(s) 54, 180
BsrI ACTGG 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 77
Bst2UI CCWGG 1 cut(s) 78
BstAPI GCANNNNNTGC 1 cut(s) 71
BstBI TTCGAA 2 cut(s) 137, 167
BstF5I GGATG 1 cut(s) 124
BstMWI GCNNNNNNNGC 3 cut(s) 59, 71, 80
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstV1I GCAGC 2 cut(s) 46, 49
BsuRI GGCC 1 cut(s) 207
BtsCI GGATG 1 cut(s) 124
CviJI RGCY 3 cut(s) 118, 152, 207
CviKI_1 RGCY 3 cut(s) 118, 152, 207
EaeI YGGCCR 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 76
FaiI YATR 2 cut(s) 114, 214
Fnu4HI GCNGC 2 cut(s) 60, 63
FokI GGATG 1 cut(s) 111
Fsp4HI GCNGC 2 cut(s) 60, 63
GluI GCNGC 2 cut(s) 60, 63
HaeIII GGCC 1 cut(s) 207
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 1 cut(s) 169
HphI GGTGA 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 128
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 3 cut(s) 59, 71, 80
LmnI GCTCC 2 cut(s) 79, 149
LpnPI CCDG 3 cut(s) 63, 90, 141
Lsp1109I GCAGC 2 cut(s) 46, 49
MlsI TGGCCA 1 cut(s) 207
MluNI TGGCCA 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 127
Mox20I TGGCCA 1 cut(s) 207
MscI TGGCCA 1 cut(s) 207
MseI TTAA 1 cut(s) 174
Msp20I TGGCCA 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
MwoI GCNNNNNNNGC 3 cut(s) 59, 71, 80
NspV TTCGAA 2 cut(s) 137, 167
PfeI GAWTC 1 cut(s) 169
PkrI GCNGC 2 cut(s) 61, 64
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 2 cut(s) 60, 63
ScrFI CCNGG 1 cut(s) 78
SetI ASST 3 cut(s) 15, 120, 154
SfuI TTCGAA 2 cut(s) 137, 167
SgeI CNNG 7 cut(s) 23, 89, 90, 107, 131, 140, 210
SspI AATATT 2 cut(s) 27, 49
StyD4I CCNGG 1 cut(s) 76
TaqI TCGA 2 cut(s) 137, 167
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 2 cut(s) 59, 62
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.