Rh2BG522000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0003702
Physical Location & Seq
Reverse (-)
73235549 .. 73235758
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG522000.1

Sequence Viewer

Length: 210 bp
ATGAGGTCTTCTTGGGCGACAACACCCGGATGGGTCCGGTTTTTCCAGGTCTTCAACCGCAACCGTATAAGTCAACGGGATCTAAACGACACCGACGACGCCATGCCGATGTTGTCGTTGTCCACGTCCGCCGGTTTCGTCTCCTTCCCATTGAATAGCAAGTCAACCGGAGAAGAAGATAAACCAAACTCATCTCCTGGGTTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.69

Weight (kDa)

6.05

Isoelectric Point (pI)

37.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 58, 129
AclWI GGATC 1 cut(s) 87
AcyI GRCGYC 1 cut(s) 99
AgsI TTSAA 2 cut(s) 55, 154
AjiI CACGTC 1 cut(s) 126
AjnI CCWGG 2 cut(s) 45, 196
Alw26I GTCTC 1 cut(s) 145
AlwI GGATC 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 34
AsuC2I CCSGG 1 cut(s) 27
AvaII GGWCC 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 43
BccI CCATC 1 cut(s) 24
BciT130I CCWGG 2 cut(s) 47, 198
BcnI CCSGG 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 145
Bme1390I CCNGG 3 cut(s) 27, 47, 198
Bme18I GGWCC 1 cut(s) 34
BmgBI CACGTC 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 34
BmiI GGNNCC 1 cut(s) 35
BmrFI CCNGG 3 cut(s) 27, 47, 198
BpiI GAAGAC 1 cut(s) 43
BpuMI CCSGG 1 cut(s) 27
BsaHI GRCGYC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 197
BsaWI WCCGGW 2 cut(s) 36, 167
Bse118I RCCGGY 1 cut(s) 131
BseBI CCWGG 2 cut(s) 47, 198
BseDI CCNNGG 1 cut(s) 197
BseGI GGATG 1 cut(s) 35
BsiSI CCGG 4 cut(s) 27, 37, 132, 168
BsmAI GTCTC 1 cut(s) 145
BsmBI CGTCTC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 2 cut(s) 58, 129
BspLI GGNNCC 1 cut(s) 35
BspPI GGATC 1 cut(s) 87
BsrFI RCCGGY 1 cut(s) 131
BssAI RCCGGY 1 cut(s) 131
BssECI CCNNGG 1 cut(s) 197
BssMI GATC 1 cut(s) 79
BssNI GRCGYC 1 cut(s) 99
Bst2UI CCWGG 2 cut(s) 47, 198
Bst4CI ACNGT 1 cut(s) 65
BstACI GRCGYC 1 cut(s) 99
BstF5I GGATG 1 cut(s) 35
BstKTI GATC 1 cut(s) 82
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 2 cut(s) 47, 198
BstSCI CCNGG 3 cut(s) 25, 45, 196
BstV2I GAAGAC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BtrI CACGTC 1 cut(s) 126
BtsCI GGATG 1 cut(s) 35
Cfr10I RCCGGY 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 34
CseI GACGC 1 cut(s) 107
CviAII CATG 1 cut(s) 103
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
EciI GGCGGA 1 cut(s) 118
Eco47I GGWCC 1 cut(s) 34
EcoRII CCWGG 2 cut(s) 45, 196
Esp3I CGTCTC 1 cut(s) 145
FaeI CATG 1 cut(s) 106
FaiI YATR 2 cut(s) 68, 104
FatI CATG 1 cut(s) 102
FokI GGATG 1 cut(s) 42
HapII CCGG 4 cut(s) 27, 37, 132, 168
HgaI GACGC 1 cut(s) 107
Hin1I GRCGYC 1 cut(s) 99
Hin1II CATG 1 cut(s) 106
HincII GTYRAC 2 cut(s) 74, 165
HindII GTYRAC 2 cut(s) 74, 165
HpaII CCGG 4 cut(s) 27, 37, 132, 168
Hpy166II GTNNAC 3 cut(s) 74, 123, 165
Hpy8I GTNNAC 3 cut(s) 74, 123, 165
Hpy99I CGWCG 2 cut(s) 98, 101
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4IV ACGT 1 cut(s) 125
HpySE526I ACGT 1 cut(s) 125
Hsp92I GRCGYC 1 cut(s) 99
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 7 cut(s) 32, 40, 50, 59, 145, 181, 183
MaeII ACGT 1 cut(s) 125
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 3 cut(s) 43, 185, 188
MflI RGATCY 1 cut(s) 79
MslI CAYNNNNRTG 2 cut(s) 28, 107
MspI CCGG 4 cut(s) 27, 37, 132, 168
MspR9I CCNGG 3 cut(s) 27, 47, 198
MvaI CCWGG 2 cut(s) 47, 198
NciI CCSGG 1 cut(s) 27
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 106
NlaIV GGNNCC 1 cut(s) 35
PcsI WCGNNNNNNNCGW 2 cut(s) 93, 122
Psp6I CCWGG 2 cut(s) 45, 196
PspGI CCWGG 2 cut(s) 45, 196
PspN4I GGNNCC 1 cut(s) 35
PspPI GGNCC 1 cut(s) 34
PsuI RGATCY 1 cut(s) 79
RseI CAYNNNNRTG 2 cut(s) 28, 107
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 3 cut(s) 27, 47, 198
SetI ASST 3 cut(s) 8, 51, 128
SinI GGWCC 1 cut(s) 34
SmiMI CAYNNNNRTG 2 cut(s) 28, 107
SsiI CCGC 2 cut(s) 58, 129
StyD4I CCNGG 3 cut(s) 25, 45, 196
TaaI ACNGT 1 cut(s) 65
TaiI ACGT 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.