Rh6BG041100

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
6721593 .. 6723980
2388 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG041100.1

Sequence Viewer

Length: 336 bp
ATGGCTGATGCTCTAGCAGATATGAAAAAAGATGGTGCTTCACCTTCTGAAGGCCATCCTACAGTTAACCTAAAGAACAAACCTACTAAAGATGTCCACAAACATCCAGACACATCAAAACCAGCGTGGCTTTTGGCTTTGGAAATATTGGATTGGGGTGAGAACAATATTGCCATTGCTGCTGCAACTACTACTCCTGGGGCGTTGTTTCAGCAAGTTGTTGTTGTTTGGCATAAGCTTGACCATCCAAATATTTCGAAGTTTGTTGGAGCTTCAATGGGAAGTTCGAATCTTAAAATCATTGCCAAAGGCACATCAAGTGGTGGTCAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

11.71

Weight (kDa)

8.06

Isoelectric Point (pI)

35.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 50
AgsI TTSAA 1 cut(s) 276
AjnI CCWGG 1 cut(s) 196
AluBI AGCT 2 cut(s) 238, 272
AluI AGCT 2 cut(s) 238, 272
AoxI GGCC 1 cut(s) 52
ApeKI GCWGC 2 cut(s) 179, 182
AsuHPI GGTGA 2 cut(s) 33, 170
AsuII TTCGAA 2 cut(s) 257, 287
BbvI GCAGC 2 cut(s) 166, 169
BccI CCATC 3 cut(s) 26, 63, 252
BciT130I CCWGG 1 cut(s) 198
BfaI CTAG 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 60
BisI GCNGC 2 cut(s) 180, 183
BlsI GCNGC 2 cut(s) 181, 184
Bme1390I CCNGG 1 cut(s) 198
BmrFI CCNGG 1 cut(s) 198
Bpu14I TTCGAA 2 cut(s) 257, 287
BsaJI CCNNGG 1 cut(s) 197
BsaXI ACNNNNNCTCC 2 cut(s) 178, 208
Bsc4I CCNNNNNNNGG 1 cut(s) 50
Bse3DI GCAATG 2 cut(s) 174, 300
BseBI CCWGG 1 cut(s) 198
BseDI CCNNGG 1 cut(s) 197
BseGI GGATG 3 cut(s) 55, 103, 244
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMI GCAATG 2 cut(s) 174, 300
BseXI GCAGC 2 cut(s) 166, 169
BshFI GGCC 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 50
BsnI GGCC 1 cut(s) 54
Bsp119I TTCGAA 2 cut(s) 257, 287
BspANI GGCC 1 cut(s) 54
BspT104I TTCGAA 2 cut(s) 257, 287
BsrDI GCAATG 2 cut(s) 174, 300
BssECI CCNNGG 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 64
BstBI TTCGAA 2 cut(s) 257, 287
BstENI CCTNNNNNAGG 1 cut(s) 48
BstF5I GGATG 3 cut(s) 55, 103, 244
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNI CCWGG 1 cut(s) 198
BstSCI CCNGG 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 60
BstV1I GCAGC 2 cut(s) 166, 169
BsuRI GGCC 1 cut(s) 54
BtsCI GGATG 3 cut(s) 55, 103, 244
CviJI RGCY 6 cut(s) 5, 54, 130, 137, 238, 272
CviKI_1 RGCY 6 cut(s) 5, 54, 130, 137, 238, 272
Eco57I CTGAAG 1 cut(s) 69
EcoNI CCTNNNNNAGG 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 196
FaiI YATR 3 cut(s) 23, 234, 334
Fnu4HI GCNGC 2 cut(s) 180, 183
FokI GGATG 3 cut(s) 42, 90, 231
Fsp4HI GCNGC 2 cut(s) 180, 183
FspBI CTAG 1 cut(s) 14
GluI GCNGC 2 cut(s) 180, 183
HaeIII GGCC 1 cut(s) 54
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HindIII AAGCTT 1 cut(s) 236
HinfI GANTC 1 cut(s) 289
HpaI GTTAAC 1 cut(s) 67
HphI GGTGA 2 cut(s) 33, 170
Hpy166II GTNNAC 2 cut(s) 67, 97
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 67, 97
HpyAV CCTTC 2 cut(s) 44, 54
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
KspAI GTTAAC 1 cut(s) 67
LmnI GCTCC 1 cut(s) 269
LpnPI CCDG 4 cut(s) 120, 135, 183, 210
Lsp1109I GCAGC 2 cut(s) 166, 169
MaeI CTAG 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 247
MseI TTAA 2 cut(s) 66, 294
MspR9I CCNGG 1 cut(s) 198
MvaI CCWGG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 179
NspV TTCGAA 2 cut(s) 257, 287
PfeI GAWTC 1 cut(s) 289
PkrI GCNGC 2 cut(s) 181, 184
Psp6I CCWGG 1 cut(s) 196
PspGI CCWGG 1 cut(s) 196
SaqAI TTAA 2 cut(s) 66, 294
SatI GCNGC 2 cut(s) 180, 183
ScrFI CCNGG 1 cut(s) 198
SetI ASST 5 cut(s) 46, 72, 85, 240, 274
SfcI CTRYAG 1 cut(s) 60
SfuI TTCGAA 2 cut(s) 257, 287
SgeI CNNG 9 cut(s) 26, 119, 134, 138, 209, 210, 227, 251, 330
SspI AATATT 3 cut(s) 147, 169, 253
SspMI CTAG 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 2 cut(s) 257, 287
TfiI GAWTC 1 cut(s) 289
Tru1I TTAA 2 cut(s) 66, 294
Tru9I TTAA 2 cut(s) 66, 294
TseI GCWGC 2 cut(s) 179, 182
TspDTI ATGAA 1 cut(s) 38
XagI CCTNNNNNAGG 1 cut(s) 48
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.