RchiOBHm_Chr6g0274731

Alba

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0002565
Physical Location & Seq
Forward (+)
36276220 .. 36277296
1077 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24647

Sequence Viewer

Length: 510 bp
ATGGATCGGTATCAGAGGATAGAGAAGCCTCGGGAGGAAACGCCCATTAACGAGAATGAGATTCGCATTACCACTCAGGGCAGAATCAGGAACTACATTACCTACGCCACCACTCTCCTCCAGGAGAAAGGGTCCAATGAAATTTCTCTCAAAGCCATGGGCAGAGCTATCAACAAGACTGTGATGATCACTGAACTCATTAAGAGGAGGGTTGCCGGCCTTCATCAAAACACCTATATTGGCTCTACTGATATAACTGACATGTGGGAGCCACTAGAAGAAGGCCTTCTTCCCCTGGAAACTACTCGCCATGTTTCAGTGATTACAGTTACTTTGTCCAAGAAGGAATTGGACACGTCCTCTACAGGGTATCAGGGGCCTATCCCAGCTGATCAAGTGAAACCATGGACTGAATATGATTATGAAGGACAGGGACCTCCTAGTAGGCGAGGAAGAGGACGTGGTCGAGGAAGGGGTAGAGGAAGAGGTAATAGATCGACAACGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03008 ko03013 map03008 map03013
Pfam Domains
Protein Families
Alba

Protein Analysis

169

Amino Acids

19.18

Weight (kDa)

9.69

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Alba PF01918 19 - 83 1.7e-17 Alba
Rpp20 PF12328 40 - 110 7.9e-06 Rpp20 subunit of nuclear RNase MRP and P
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 366
AflIII ACRYGT 2 cut(s) 261, 354
AjiI CACGTC 2 cut(s) 357, 461
AjnI CCWGG 2 cut(s) 120, 294
AluBI AGCT 2 cut(s) 167, 389
AluI AGCT 2 cut(s) 167, 389
AlwI GGATC 1 cut(s) 12
Ama87I CYCGRG 1 cut(s) 30
AoxI GGCC 3 cut(s) 217, 283, 377
ApoI RAATTY 1 cut(s) 141
Asp700I GAANNNNTTC 1 cut(s) 285
AspS9I GGNCC 3 cut(s) 132, 377, 434
AvaI CYCGRG 1 cut(s) 30
AvaII GGWCC 2 cut(s) 132, 434
BciT130I CCWGG 2 cut(s) 122, 296
BclI TGATCA 2 cut(s) 186, 391
BfaI CTAG 2 cut(s) 275, 441
BfmI CTRYAG 1 cut(s) 363
Bme1390I CCNGG 2 cut(s) 122, 296
Bme18I GGWCC 2 cut(s) 132, 434
BmeT110I CYCGRG 1 cut(s) 30
BmgBI CACGTC 2 cut(s) 357, 461
BmgT120I GGNCC 3 cut(s) 132, 377, 434
BmiI GGNNCC 4 cut(s) 133, 270, 378, 435
BmrFI CCNGG 2 cut(s) 122, 296
BpmI CTGGAG 1 cut(s) 104
BsaBI GATNNNNATC 1 cut(s) 9
BsaJI CCNNGG 4 cut(s) 29, 156, 294, 404
BsaXI ACNNNNNCTCC 2 cut(s) 116, 146
Bsc4I CCNNNNNNNGG 1 cut(s) 366
Bse118I RCCGGY 1 cut(s) 215
Bse8I GATNNNNATC 1 cut(s) 9
BseBI CCWGG 2 cut(s) 122, 296
BseDI CCNNGG 4 cut(s) 29, 156, 294, 404
BseJI GATNNNNATC 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 366
BseMII CTCAG 1 cut(s) 89
BseRI GAGGAG 2 cut(s) 107, 220
BseYI CCCAGC 1 cut(s) 385
BshFI GGCC 3 cut(s) 219, 285, 379
BsiHKCI CYCGRG 1 cut(s) 30
BsiSI CCGG 1 cut(s) 216
BslFI GGGAC 1 cut(s) 447
BslI CCNNNNNNNGG 1 cut(s) 366
BsmFI GGGAC 1 cut(s) 447
BsnI GGCC 3 cut(s) 219, 285, 379
BsoBI CYCGRG 1 cut(s) 30
Bsp143I GATC 4 cut(s) 4, 186, 391, 494
Bsp19I CCATGG 2 cut(s) 156, 404
BspANI GGCC 3 cut(s) 219, 285, 379
BspCNI CTCAG 1 cut(s) 88
BspLI GGNNCC 4 cut(s) 133, 270, 378, 435
BspPI GGATC 1 cut(s) 12
BsrFI RCCGGY 1 cut(s) 215
BssAI RCCGGY 1 cut(s) 215
BssECI CCNNGG 4 cut(s) 29, 156, 294, 404
BssMI GATC 4 cut(s) 4, 186, 391, 494
BssT1I CCWWGG 2 cut(s) 156, 404
Bst2UI CCWGG 2 cut(s) 122, 296
Bst4CI ACNGT 3 cut(s) 181, 328, 505
Bst6I CTCTTC 2 cut(s) 448, 478
BstC8I GCNNGC 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 75
BstDSI CCRYGG 2 cut(s) 156, 404
BstKTI GATC 4 cut(s) 7, 189, 394, 497
BstMBI GATC 4 cut(s) 4, 186, 391, 494
BstNI CCWGG 2 cut(s) 122, 296
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 2 cut(s) 120, 294
BstSFI CTRYAG 1 cut(s) 363
BsuRI GGCC 3 cut(s) 219, 285, 379
BtgI CCRYGG 2 cut(s) 156, 404
BtrI CACGTC 2 cut(s) 357, 461
BtsIMutI CAGTG 2 cut(s) 189, 324
Cac8I GCNNGC 1 cut(s) 217
Cfr10I RCCGGY 1 cut(s) 215
Cfr13I GGNCC 3 cut(s) 132, 377, 434
CviAII CATG 4 cut(s) 157, 262, 311, 405
CviJI RGCY 9 cut(s) 28, 155, 167, 219, 243, 271, 285, 379, 389
CviKI_1 RGCY 9 cut(s) 28, 155, 167, 219, 243, 271, 285, 379, 389
DdeI CTNAG 1 cut(s) 75
DpnI GATC 4 cut(s) 6, 188, 393, 496
DpnII GATC 4 cut(s) 4, 186, 391, 494
Eam1104I CTCTTC 2 cut(s) 448, 478
EarI CTCTTC 2 cut(s) 448, 478
Eco130I CCWWGG 2 cut(s) 156, 404
Eco147I AGGCCT 1 cut(s) 285
Eco47I GGWCC 2 cut(s) 132, 434
Eco88I CYCGRG 1 cut(s) 30
EcoO109I RGGNCCY 2 cut(s) 377, 434
EcoRII CCWGG 2 cut(s) 120, 294
EcoT14I CCWWGG 2 cut(s) 156, 404
ErhI CCWWGG 2 cut(s) 156, 404
FaeI CATG 4 cut(s) 160, 265, 314, 408
FaiI YATR 8 cut(s) 158, 237, 254, 263, 312, 406, 417, 423
FalI AAGNNNNNCTT 4 cut(s) 270, 302, 273, 305
FaqI GGGAC 1 cut(s) 447
FatI CATG 4 cut(s) 156, 261, 310, 404
FbaI TGATCA 2 cut(s) 186, 391
FspBI CTAG 2 cut(s) 275, 441
GsaI CCCAGC 1 cut(s) 389
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 3 cut(s) 219, 285, 379
HapII CCGG 1 cut(s) 216
Hin1II CATG 4 cut(s) 160, 265, 314, 408
HinfI GANTC 2 cut(s) 61, 84
HpaII CCGG 1 cut(s) 216
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 2 cut(s) 32, 88
HpyAV CCTTC 6 cut(s) 230, 275, 296, 337, 419, 465
HpyCH4III ACNGT 3 cut(s) 181, 328, 505
HpyCH4IV ACGT 2 cut(s) 356, 460
HpyF3I CTNAG 1 cut(s) 75
HpySE526I ACGT 2 cut(s) 356, 460
Hsp92II CATG 4 cut(s) 160, 265, 314, 408
KroI GCCGGC 1 cut(s) 215
KroNI GCCGGC 1 cut(s) 217
Ksp22I TGATCA 2 cut(s) 186, 391
Kzo9I GATC 4 cut(s) 4, 186, 391, 494
LmnI GCTCC 1 cut(s) 268
MaeI CTAG 2 cut(s) 275, 441
MaeII ACGT 2 cut(s) 356, 460
MaeIII GTNAC 1 cut(s) 328
MalI GATC 4 cut(s) 6, 188, 393, 496
MboI GATC 4 cut(s) 4, 186, 391, 494
MboII GAAGA 4 cut(s) 281, 290, 465, 495
MluCI AATT 2 cut(s) 141, 347
MroNI GCCGGC 1 cut(s) 215
MroXI GAANNNNTTC 1 cut(s) 285
MseI TTAA 3 cut(s) 48, 201, 508
MspA1I CMGCKG 1 cut(s) 389
MspI CCGG 1 cut(s) 216
MspR9I CCNGG 2 cut(s) 122, 296
MvaI CCWGG 2 cut(s) 122, 296
NaeI GCCGGC 1 cut(s) 217
NcoI CCATGG 2 cut(s) 156, 404
NdeII GATC 4 cut(s) 4, 186, 391, 494
NgoMIV GCCGGC 1 cut(s) 215
NlaIII CATG 4 cut(s) 160, 265, 314, 408
NlaIV GGNNCC 4 cut(s) 133, 270, 378, 435
NspI RCATGY 1 cut(s) 265
PceI AGGCCT 1 cut(s) 285
PciI ACATGT 1 cut(s) 261
PdiI GCCGGC 1 cut(s) 217
PdmI GAANNNNTTC 1 cut(s) 285
PfeI GAWTC 2 cut(s) 61, 84
PflFI GACNNNGTC 1 cut(s) 462
PfoI TCCNGGA 1 cut(s) 120
PpuMI RGGWCCY 1 cut(s) 434
PscI ACATGT 1 cut(s) 261
Psp5II RGGWCCY 1 cut(s) 434
Psp6I CCWGG 2 cut(s) 120, 294
PspFI CCCAGC 1 cut(s) 385
PspGI CCWGG 2 cut(s) 120, 294
PspN4I GGNNCC 4 cut(s) 133, 270, 378, 435
PspPI GGNCC 3 cut(s) 132, 377, 434
PspPPI RGGWCCY 1 cut(s) 434
PsyI GACNNNGTC 1 cut(s) 462
PvuII CAGCTG 1 cut(s) 389
SaqAI TTAA 3 cut(s) 48, 201, 508
Sau3AI GATC 4 cut(s) 4, 186, 391, 494
Sau96I GGNCC 3 cut(s) 132, 377, 434
ScrFI CCNGG 2 cut(s) 122, 296
SetI ASST 8 cut(s) 104, 169, 236, 359, 391, 439, 463, 490
SfcI CTRYAG 1 cut(s) 363
SinI GGWCC 2 cut(s) 132, 434
Sse9I AATT 2 cut(s) 141, 347
SseBI AGGCCT 1 cut(s) 285
SspMI CTAG 2 cut(s) 275, 441
StuI AGGCCT 1 cut(s) 285
StyD4I CCNGG 2 cut(s) 120, 294
StyI CCWWGG 2 cut(s) 156, 404
TaaI ACNGT 3 cut(s) 181, 328, 505
TaiI ACGT 2 cut(s) 359, 463
TaqI TCGA 2 cut(s) 466, 497
TasI AATT 2 cut(s) 141, 347
TfiI GAWTC 2 cut(s) 61, 84
Tru1I TTAA 3 cut(s) 48, 201, 508
Tru9I TTAA 3 cut(s) 48, 201, 508
TscAI CASTG 2 cut(s) 196, 324
TspDTI ATGAA 3 cut(s) 153, 212, 438
TspRI CASTG 2 cut(s) 196, 324
Tth111I GACNNNGTC 1 cut(s) 462
VpaK11BI GGWCC 2 cut(s) 132, 434
XapI RAATTY 1 cut(s) 141
XceI RCATGY 1 cut(s) 265
XcmI CCANNNNNNNNNTGG 1 cut(s) 346
XmnI GAANNNNTTC 1 cut(s) 285
XspI CTAG 2 cut(s) 275, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.