Rmu_sc0006223.1_g000010

Alba

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006223.1
Physical Location & Seq
Reverse (-)
42565 .. 45121
2557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006223.1_g000010.1.cds

Sequence Viewer

Length: 855 bp
atggatcggtatcagaggatagagaagcctcgggaggaaacgcccattaacgagaatgagattcgcattaccactcagggcagaatcaggaactacattacctacgccaccactctcctccaggagaaagggtccaatgaaatatctctcaaagccatgggtagagctatcaacaagactaggagggttgccggccttcatcaaaacacctatattggctctactgatataactgacatgtgggagccactagaagaaggtcttcttcccctggaaactactcgccatgtttcagtgattacagttactttgtccaagaaggaattggacacgtcctctacagggtatcagggacctatcccagctgatcaagtgaaaccatggactgaatatgattatgaaggacgtaaggccacaagttatgatctcactattagggacctcctagtatgcgaggaagaggacgtggtcgaggaaggggtagacgaagaggtaatagacgacgggaattttagtaacggagtgatggtatacaatgctgatggcggtttcgatggtggtcggggctatggtgggtttgatggtggtcgtggctatggtgggtttgaaggtgggcgtggctatggtggcaggggtcagggtcgtggaagagtccgcggttatcgtgggcgtgtgcgaggatatggcagtggaagtatgcaaccagaatccggtggttatactgtttataatgattatggaggtggagctccttctgcacaaggtcgtgggagagagcggggaccaggcagagcaagaggcggtggccgcggtataggtggtagattagatggacctatccagagtgctgtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

284

Amino Acids

30.91

Weight (kDa)

5.5

Isoelectric Point (pI)

26.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 729
AccBSI CCGCTC 1 cut(s) 778
AccI GTMKAC 2 cut(s) 483, 531
AccII CGCG 2 cut(s) 657, 810
AciI CCGC 7 cut(s) 546, 655, 657, 778, 801, 808, 810
AclWI GGATC 1 cut(s) 12
AcoI YGGCCR 1 cut(s) 805
AcsI RAATTY 1 cut(s) 508
AfiI CCNNNNNNNGG 2 cut(s) 342, 710
AflIII ACRYGT 2 cut(s) 237, 330
AgsI TTSAA 1 cut(s) 608
AjiI CACGTC 2 cut(s) 333, 466
AjnI CCWGG 3 cut(s) 120, 270, 784
AluBI AGCT 3 cut(s) 167, 365, 749
AluI AGCT 3 cut(s) 167, 365, 749
Alw21I GWGCWC 1 cut(s) 751
AlwI GGATC 1 cut(s) 12
Ama87I CYCGRG 1 cut(s) 30
AoxI GGCC 3 cut(s) 193, 411, 805
ApoI RAATTY 1 cut(s) 508
Asp700I GAANNNNTTC 1 cut(s) 261
AspS9I GGNCC 5 cut(s) 132, 353, 439, 782, 833
AvaI CYCGRG 1 cut(s) 30
AvaII GGWCC 5 cut(s) 132, 353, 439, 782, 833
BanII GRGCYC 1 cut(s) 751
BbsI GAAGAC 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 751
BccI CCATC 5 cut(s) 520, 536, 548, 575, 824
BciT130I CCWGG 3 cut(s) 122, 272, 786
BclI TGATCA 1 cut(s) 367
BfaI CTAG 3 cut(s) 180, 251, 446
BfmI CTRYAG 1 cut(s) 339
BisI GCNGC 1 cut(s) 808
BlsI GCNGC 1 cut(s) 809
Bme1390I CCNGG 3 cut(s) 122, 272, 786
Bme18I GGWCC 5 cut(s) 132, 353, 439, 782, 833
BmeT110I CYCGRG 1 cut(s) 30
BmgBI CACGTC 2 cut(s) 333, 466
BmgT120I GGNCC 5 cut(s) 132, 353, 439, 782, 833
BmiI GGNNCC 5 cut(s) 133, 246, 354, 440, 783
BmrFI CCNGG 3 cut(s) 122, 272, 786
BpiI GAAGAC 1 cut(s) 254
BpmI CTGGAG 1 cut(s) 104
BsaBI GATNNNNATC 1 cut(s) 9
BsaJI CCNNGG 6 cut(s) 29, 156, 270, 380, 655, 808
BsaWI WCCGGW 1 cut(s) 710
BsaXI ACNNNNNCTCC 4 cut(s) 116, 146, 513, 543
Bsc4I CCNNNNNNNGG 2 cut(s) 342, 710
Bse118I RCCGGY 1 cut(s) 191
Bse8I GATNNNNATC 1 cut(s) 9
BseBI CCWGG 3 cut(s) 122, 272, 786
BseDI CCNNGG 6 cut(s) 29, 156, 270, 380, 655, 808
BseJI GATNNNNATC 1 cut(s) 9
BseLI CCNNNNNNNGG 2 cut(s) 342, 710
BseMII CTCAG 1 cut(s) 89
BseRI GAGGAG 1 cut(s) 107
BseYI CCCAGC 1 cut(s) 361
BsgI GTGCAG 1 cut(s) 741
Bsh1236I CGCG 2 cut(s) 657, 810
BshFI GGCC 3 cut(s) 195, 413, 807
BsiHKAI GWGCWC 1 cut(s) 751
BsiHKCI CYCGRG 1 cut(s) 30
BsiSI CCGG 2 cut(s) 192, 711
BslFI GGGAC 3 cut(s) 366, 452, 795
BslI CCNNNNNNNGG 2 cut(s) 342, 710
BsmFI GGGAC 3 cut(s) 366, 452, 795
BsnI GGCC 3 cut(s) 195, 413, 807
BsoBI CYCGRG 1 cut(s) 30
Bsp1286I GDGCHC 1 cut(s) 751
Bsp143I GATC 3 cut(s) 4, 367, 424
Bsp19I CCATGG 2 cut(s) 156, 380
BspACI CCGC 7 cut(s) 546, 655, 657, 778, 801, 808, 810
BspANI GGCC 3 cut(s) 195, 413, 807
BspCNI CTCAG 1 cut(s) 88
BspFNI CGCG 2 cut(s) 657, 810
BspLI GGNNCC 5 cut(s) 133, 246, 354, 440, 783
BspPI GGATC 1 cut(s) 12
BsrBI CCGCTC 1 cut(s) 778
BsrFI RCCGGY 1 cut(s) 191
BssAI RCCGGY 1 cut(s) 191
BssECI CCNNGG 6 cut(s) 29, 156, 270, 380, 655, 808
BssMI GATC 3 cut(s) 4, 367, 424
BssNAI GTATAC 1 cut(s) 532
BssT1I CCWWGG 2 cut(s) 156, 380
Bst1107I GTATAC 1 cut(s) 532
Bst2UI CCWGG 3 cut(s) 122, 272, 786
Bst4CI ACNGT 2 cut(s) 304, 724
Bst6I CTCTTC 3 cut(s) 453, 483, 643
BstC8I GCNNGC 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 75
BstDSI CCRYGG 4 cut(s) 156, 380, 655, 808
BstFNI CGCG 2 cut(s) 657, 810
BstKTI GATC 3 cut(s) 7, 370, 427
BstMBI GATC 3 cut(s) 4, 367, 424
BstMWI GCNNNNNNNGC 3 cut(s) 627, 755, 807
BstNI CCWGG 3 cut(s) 122, 272, 786
BstNSI RCATGY 1 cut(s) 241
BstSCI CCNGG 3 cut(s) 120, 270, 784
BstSFI CTRYAG 1 cut(s) 339
BstUI CGCG 2 cut(s) 657, 810
BstV2I GAAGAC 1 cut(s) 254
BstZ17I GTATAC 1 cut(s) 532
BsuRI GGCC 3 cut(s) 195, 413, 807
BtgI CCRYGG 4 cut(s) 156, 380, 655, 808
BtrI CACGTC 2 cut(s) 333, 466
BtsI GCAGTG 1 cut(s) 694
BtsIMutI CAGTG 2 cut(s) 300, 694
Cac8I GCNNGC 1 cut(s) 193
Cfr10I RCCGGY 1 cut(s) 191
Cfr13I GGNCC 5 cut(s) 132, 353, 439, 782, 833
Cfr42I CCGCGG 2 cut(s) 658, 811
CviAII CATG 4 cut(s) 157, 238, 287, 381
DdeI CTNAG 1 cut(s) 75
DpnI GATC 3 cut(s) 6, 369, 426
DpnII GATC 3 cut(s) 4, 367, 424
EaeI YGGCCR 1 cut(s) 805
Eam1104I CTCTTC 3 cut(s) 453, 483, 643
EarI CTCTTC 3 cut(s) 453, 483, 643
Ecl136II GAGCTC 1 cut(s) 749
Eco130I CCWWGG 2 cut(s) 156, 380
Eco24I GRGCYC 1 cut(s) 751
Eco47I GGWCC 5 cut(s) 132, 353, 439, 782, 833
Eco53kI GAGCTC 1 cut(s) 749
Eco88I CYCGRG 1 cut(s) 30
EcoICRI GAGCTC 1 cut(s) 749
EcoO109I RGGNCCY 2 cut(s) 353, 439
EcoRII CCWGG 3 cut(s) 120, 270, 784
EcoT14I CCWWGG 2 cut(s) 156, 380
EcoT38I GRGCYC 1 cut(s) 751
ErhI CCWWGG 2 cut(s) 156, 380
FaeI CATG 4 cut(s) 160, 241, 290, 384
FalI AAGNNNNNCTT 4 cut(s) 246, 278, 249, 281
FaqI GGGAC 3 cut(s) 366, 452, 795
FatI CATG 4 cut(s) 156, 237, 286, 380
FauI CCCGC 1 cut(s) 771
FbaI TGATCA 1 cut(s) 367
FblI GTMKAC 2 cut(s) 483, 531
Fnu4HI GCNGC 1 cut(s) 808
FriOI GRGCYC 1 cut(s) 751
Fsp4HI GCNGC 1 cut(s) 808
FspBI CTAG 3 cut(s) 180, 251, 446
GluI GCNGC 1 cut(s) 808
GsaI CCCAGC 1 cut(s) 365
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 3 cut(s) 195, 413, 807
HapII CCGG 2 cut(s) 192, 711
Hin1II CATG 4 cut(s) 160, 241, 290, 384
HinfI GANTC 4 cut(s) 61, 84, 651, 707
HpaII CCGG 2 cut(s) 192, 711
Hpy166II GTNNAC 2 cut(s) 484, 532
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 3 cut(s) 32, 88, 841
Hpy8I GTNNAC 2 cut(s) 484, 532
Hpy99I CGWCG 1 cut(s) 506
HpyAV CCTTC 7 cut(s) 206, 251, 313, 395, 470, 602, 762
HpyCH4III ACNGT 2 cut(s) 304, 724
HpyCH4IV ACGT 3 cut(s) 332, 406, 465
HpyCH4V TGCA 2 cut(s) 700, 758
HpyF10VI GCNNNNNNNGC 3 cut(s) 627, 755, 807
HpyF3I CTNAG 1 cut(s) 75
HpySE526I ACGT 3 cut(s) 332, 406, 465
Hsp92II CATG 4 cut(s) 160, 241, 290, 384
KroI GCCGGC 1 cut(s) 191
KroNI GCCGGC 1 cut(s) 193
Ksp22I TGATCA 1 cut(s) 367
KspI CCGCGG 2 cut(s) 658, 811
Kzo9I GATC 3 cut(s) 4, 367, 424
LmnI GCTCC 3 cut(s) 244, 746, 754
MaeI CTAG 3 cut(s) 180, 251, 446
MaeII ACGT 3 cut(s) 332, 406, 465
MaeIII GTNAC 2 cut(s) 304, 515
MalI GATC 3 cut(s) 6, 369, 426
MbiI CCGCTC 1 cut(s) 778
MboI GATC 3 cut(s) 4, 367, 424
MboII GAAGA 6 cut(s) 254, 257, 266, 470, 500, 660
MhlI GDGCHC 1 cut(s) 751
MluCI AATT 2 cut(s) 323, 508
MlyI GAGTC 1 cut(s) 660
MroNI GCCGGC 1 cut(s) 191
MroXI GAANNNNTTC 1 cut(s) 261
MseI TTAA 1 cut(s) 48
MspA1I CMGCKG 3 cut(s) 365, 657, 810
MspI CCGG 2 cut(s) 192, 711
MspR9I CCNGG 3 cut(s) 122, 272, 786
MvaI CCWGG 3 cut(s) 122, 272, 786
MvnI CGCG 2 cut(s) 657, 810
MwoI GCNNNNNNNGC 3 cut(s) 627, 755, 807
NaeI GCCGGC 1 cut(s) 193
NcoI CCATGG 2 cut(s) 156, 380
NdeII GATC 3 cut(s) 4, 367, 424
NgoMIV GCCGGC 1 cut(s) 191
NlaIII CATG 4 cut(s) 160, 241, 290, 384
NlaIV GGNNCC 5 cut(s) 133, 246, 354, 440, 783
NspI RCATGY 1 cut(s) 241
PciI ACATGT 1 cut(s) 237
PdiI GCCGGC 1 cut(s) 193
PdmI GAANNNNTTC 1 cut(s) 261
PfeI GAWTC 3 cut(s) 61, 84, 707
PflFI GACNNNGTC 1 cut(s) 467
PfoI TCCNGGA 1 cut(s) 120
PkrI GCNGC 1 cut(s) 809
PleI GAGTC 1 cut(s) 659
PpsI GAGTC 1 cut(s) 659
PpuMI RGGWCCY 2 cut(s) 353, 439
PscI ACATGT 1 cut(s) 237
PsiI TTATAA 1 cut(s) 729
Psp124BI GAGCTC 1 cut(s) 751
Psp5II RGGWCCY 2 cut(s) 353, 439
Psp6I CCWGG 3 cut(s) 120, 270, 784
PspFI CCCAGC 1 cut(s) 361
PspGI CCWGG 3 cut(s) 120, 270, 784
PspN4I GGNNCC 5 cut(s) 133, 246, 354, 440, 783
PspPI GGNCC 5 cut(s) 132, 353, 439, 782, 833
PspPPI RGGWCCY 2 cut(s) 353, 439
PsyI GACNNNGTC 1 cut(s) 467
PvuII CAGCTG 1 cut(s) 365
SacI GAGCTC 1 cut(s) 751
SacII CCGCGG 2 cut(s) 658, 811
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 808
Sau3AI GATC 3 cut(s) 4, 367, 424
Sau96I GGNCC 5 cut(s) 132, 353, 439, 782, 833
SchI GAGTC 1 cut(s) 660
ScrFI CCNGG 3 cut(s) 122, 272, 786
SduI GDGCHC 1 cut(s) 751
SfcI CTRYAG 1 cut(s) 339
Sfr303I CCGCGG 2 cut(s) 658, 811
SgrBI CCGCGG 2 cut(s) 658, 811
SinI GGWCC 5 cut(s) 132, 353, 439, 782, 833
Sse9I AATT 2 cut(s) 323, 508
SsiI CCGC 7 cut(s) 546, 655, 657, 778, 801, 808, 810
SspMI CTAG 3 cut(s) 180, 251, 446
SstI GAGCTC 1 cut(s) 751
StyD4I CCNGG 3 cut(s) 120, 270, 784
StyI CCWWGG 2 cut(s) 156, 380
TaaI ACNGT 2 cut(s) 304, 724
TaiI ACGT 3 cut(s) 335, 409, 468
TaqI TCGA 2 cut(s) 471, 552
TasI AATT 2 cut(s) 323, 508
TauI GCSGC 1 cut(s) 810
TfiI GAWTC 3 cut(s) 61, 84, 707
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 2 cut(s) 300, 694
TspDTI ATGAA 3 cut(s) 153, 188, 414
TspGWI ACGGA 1 cut(s) 534
TspRI CASTG 2 cut(s) 300, 694
Tth111I GACNNNGTC 1 cut(s) 467
VpaK11BI GGWCC 5 cut(s) 132, 353, 439, 782, 833
XapI RAATTY 1 cut(s) 508
XceI RCATGY 1 cut(s) 241
XcmI CCANNNNNNNNNTGG 1 cut(s) 322
XmiI GTMKAC 2 cut(s) 483, 531
XmnI GAANNNNTTC 1 cut(s) 261
XspI CTAG 3 cut(s) 180, 251, 446
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.